ID: 1182421849

View in Genome Browser
Species Human (GRCh38)
Location 22:30252449-30252471
Sequence TGTTGAAAGCAGGCCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182421845_1182421849 -10 Left 1182421845 22:30252436-30252458 CCACTGGTATCGATGTTGAAAGC No data
Right 1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182421849 Original CRISPR TGTTGAAAGCAGGCCCAGAG GGG Intergenic
No off target data available for this crispr