ID: 1182422766

View in Genome Browser
Species Human (GRCh38)
Location 22:30256563-30256585
Sequence GACCCAGGACTGGCCCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182422757_1182422766 6 Left 1182422757 22:30256534-30256556 CCCAGCGTGCCAGGGAACCCCAG No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422749_1182422766 17 Left 1182422749 22:30256523-30256545 CCCCACCCTGCCCCAGCGTGCCA No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422758_1182422766 5 Left 1182422758 22:30256535-30256557 CCAGCGTGCCAGGGAACCCCAGC No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422747_1182422766 24 Left 1182422747 22:30256516-30256538 CCCAGGTCCCCACCCTGCCCCAG No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422754_1182422766 12 Left 1182422754 22:30256528-30256550 CCCTGCCCCAGCGTGCCAGGGAA No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422750_1182422766 16 Left 1182422750 22:30256524-30256546 CCCACCCTGCCCCAGCGTGCCAG No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422751_1182422766 15 Left 1182422751 22:30256525-30256547 CCACCCTGCCCCAGCGTGCCAGG No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422756_1182422766 7 Left 1182422756 22:30256533-30256555 CCCCAGCGTGCCAGGGAACCCCA No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422748_1182422766 23 Left 1182422748 22:30256517-30256539 CCAGGTCCCCACCCTGCCCCAGC No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422759_1182422766 -3 Left 1182422759 22:30256543-30256565 CCAGGGAACCCCAGCATCCAGAC No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data
1182422755_1182422766 11 Left 1182422755 22:30256529-30256551 CCTGCCCCAGCGTGCCAGGGAAC No data
Right 1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182422766 Original CRISPR GACCCAGGACTGGCCCACCC CGG Intergenic
No off target data available for this crispr