ID: 1182424666

View in Genome Browser
Species Human (GRCh38)
Location 22:30265817-30265839
Sequence AAGGAGCCACTTATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182424666_1182424669 -6 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424669 22:30265834-30265856 CTCCTTCTGTCAGGCCCACCAGG No data
1182424666_1182424678 25 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424678 22:30265865-30265887 GAGCCTGTCAGAAGGTGTTGGGG 0: 1
1: 0
2: 3
3: 16
4: 253
1182424666_1182424675 17 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424675 22:30265857-30265879 GATGCTGTGAGCCTGTCAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 188
1182424666_1182424670 -5 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424670 22:30265835-30265857 TCCTTCTGTCAGGCCCACCAGGG No data
1182424666_1182424681 29 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424681 22:30265869-30265891 CTGTCAGAAGGTGTTGGGGGCGG 0: 1
1: 0
2: 3
3: 43
4: 385
1182424666_1182424676 23 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424676 22:30265863-30265885 GTGAGCCTGTCAGAAGGTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 214
1182424666_1182424677 24 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424677 22:30265864-30265886 TGAGCCTGTCAGAAGGTGTTGGG 0: 1
1: 0
2: 1
3: 19
4: 313
1182424666_1182424682 30 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424682 22:30265870-30265892 TGTCAGAAGGTGTTGGGGGCGGG 0: 1
1: 0
2: 2
3: 30
4: 398
1182424666_1182424679 26 Left 1182424666 22:30265817-30265839 CCTCTCTCCATAAGTGGCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1182424679 22:30265866-30265888 AGCCTGTCAGAAGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182424666 Original CRISPR AAGGAGCCACTTATGGAGAG AGG (reversed) Intronic
900954718 1:5879440-5879462 AAGAAGCCAATTATGGAGCTTGG - Intronic
904920608 1:34005033-34005055 GAAGAGCCACTGATGGAAAGTGG - Intronic
904978177 1:34474435-34474457 AAGGAGACAGTTATGTCGAGTGG + Intergenic
905756131 1:40510795-40510817 AAGTAGCCACATATGGCTAGTGG + Intronic
906148048 1:43571526-43571548 AGGGTGCCACTTATGGAAAGAGG - Intronic
906676414 1:47696849-47696871 GAGGCGCCACTGCTGGAGAGAGG - Intergenic
906865085 1:49409413-49409435 AATGAGACACTTTTGGGGAGGGG + Intronic
909554571 1:76939250-76939272 AAGGAGCCAGTTCTGGCGATAGG + Intronic
910599736 1:89018347-89018369 AATGAGACCCTTGTGGAGAGAGG + Intronic
915719469 1:157973725-157973747 AAGGAGACATTGAAGGAGAGTGG - Intergenic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
917134851 1:171779961-171779983 TAGGAAGCACTTATTGAGAGCGG - Intergenic
919675311 1:200376480-200376502 AAGTAGCCACTTGTGGCCAGAGG + Intergenic
921876291 1:220200211-220200233 AAGGAGCCAGCTATGGAAAGAGG - Intronic
922519338 1:226234837-226234859 AAGAAGGCAGTTATGAAGAGGGG - Intronic
1066398834 10:35054438-35054460 AATGAACCACTTATGGAAATAGG - Exonic
1067516608 10:46952381-46952403 AAAGAGACACTTTTGGAGAAGGG - Intronic
1067645643 10:48099412-48099434 AAAGAGACACTTTTGGAGAAGGG + Intergenic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1074215289 10:111378321-111378343 AGGAAGCCACTTCTGGAGTGTGG - Intergenic
1075017933 10:118924614-118924636 AAGGAGCCCTCTAGGGAGAGGGG + Intergenic
1076241913 10:128915217-128915239 AAGGAGCCCTTCCTGGAGAGAGG - Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1077093668 11:790404-790426 AGGGAGCCAGTTATGGGAAGAGG + Intergenic
1078271400 11:9798361-9798383 AAGGAGCCAGTGATGGAGAGGGG + Intronic
1078881348 11:15452059-15452081 AATGAGACACTTACGGTGAGAGG - Intergenic
1080467100 11:32507877-32507899 AATGAGCCATTTTTGGAGAATGG - Intergenic
1081098519 11:38970415-38970437 TATGAGCCACTTAGCGAGAGAGG - Intergenic
1081644168 11:44778270-44778292 TAGTAGCCTCTTATGGGGAGAGG + Intronic
1084858301 11:72002705-72002727 CAGAGGCCACTAATGGAGAGTGG + Intronic
1084947072 11:72643882-72643904 AGGGAGCCACTGAGGGTGAGTGG - Intronic
1085237437 11:75025853-75025875 AAGGAGCCAACTATGGGGACTGG + Intergenic
1087846355 11:102977902-102977924 AAGGAGTCACTCCTGGAAAGGGG + Intergenic
1087861662 11:103165577-103165599 AAGAAGCCATTTCTGAAGAGAGG + Intronic
1088553433 11:111037634-111037656 AATGAGCCATTTATGGATGGAGG - Intergenic
1089119178 11:116120261-116120283 CAGGAGGCACTTATGGCTAGTGG - Intergenic
1089239854 11:117068206-117068228 AAGGAGCCATTTTTGGGGTGTGG - Intronic
1091141409 11:133238259-133238281 CAACAGCCACCTATGGAGAGTGG - Intronic
1093874997 12:24339856-24339878 ATTGAGCCACTTCTGGAAAGAGG + Intergenic
1095163833 12:38948368-38948390 AAGGTGCCATTTATGAGGAGTGG - Intergenic
1096496325 12:52041411-52041433 CTGGAGCCCCTTAAGGAGAGTGG + Intronic
1098430968 12:70419797-70419819 AAGGAGGCACTTAGGGAGGATGG + Intronic
1101211763 12:102542064-102542086 GAAGAGCCACTTATGGAGATGGG + Intergenic
1102700362 12:114833974-114833996 AAAGAGCCACTTATGGTGGTGGG - Intergenic
1102996060 12:117351457-117351479 AAGGAGCAGCTTATGGACACAGG - Intronic
1103186306 12:118960794-118960816 ACGGAGCCACTTCTGGGAAGAGG + Intergenic
1106271243 13:28155920-28155942 AATAGGCCAATTATGGAGAGTGG + Intronic
1107360334 13:39610865-39610887 AAGGAGACAGAGATGGAGAGAGG + Intergenic
1107560530 13:41553321-41553343 AAGCTGCCATTTATGGAGATGGG - Intergenic
1107603347 13:42035368-42035390 ATGGAGCCACCTATCTAGAGGGG - Intergenic
1107735231 13:43392065-43392087 AAGGAGCCAGCTCTGGAAAGTGG - Intronic
1110299900 13:73914251-73914273 AGTGAGCCACATAGGGAGAGTGG - Intronic
1113554087 13:111217262-111217284 AAAAATCCACTAATGGAGAGTGG + Intronic
1114422191 14:22593636-22593658 AAGTAGCCACTTGTGGCTAGTGG + Intergenic
1114613551 14:24056822-24056844 AAGGAGCCACGTTTGGGGAGAGG + Intronic
1115509373 14:34124776-34124798 AAGTAGCCACTTCTAGAAAGTGG + Intronic
1118137228 14:63043912-63043934 AAGGAGCCTCTTAAGAAGAGGGG + Intronic
1118759591 14:68871904-68871926 AAAGCGCCATTCATGGAGAGGGG - Intergenic
1119650280 14:76378148-76378170 AAGAAGTCACCTCTGGAGAGAGG - Intronic
1119664035 14:76471612-76471634 AAGGAGCCAGCTTTGGGGAGAGG - Intronic
1121731879 14:96193012-96193034 CAGGAGCCAGTGATGGGGAGAGG + Intergenic
1122630045 14:103103568-103103590 AAGGAGCAATTTAAGGAGTGCGG - Intronic
1127660076 15:61092423-61092445 AAGCAGCCACTTAGGCAGAAAGG - Intronic
1128267458 15:66279249-66279271 AAGGAGCCAAGTGTGGAGAGAGG - Intergenic
1130092164 15:80830094-80830116 AAGGAGTCATTTGTGTAGAGCGG - Intronic
1130397491 15:83515594-83515616 AAAAAGTCCCTTATGGAGAGGGG - Intronic
1131883215 15:96880894-96880916 AAGATGACACATATGGAGAGTGG - Intergenic
1132201393 15:99956796-99956818 AAGGATCAACTTATACAGAGGGG + Intergenic
1132633056 16:929056-929078 AAGGAGACACTCGTGGTGAGGGG - Intronic
1137719349 16:50618802-50618824 AGGGAGCCACTGGTGAAGAGAGG + Intronic
1138772143 16:59678540-59678562 AAGGAGGAACTTTTGCAGAGAGG - Intergenic
1139421292 16:66851021-66851043 AAGGAGCCAGGTGTGGACAGGGG - Intronic
1142299825 16:89250122-89250144 ATGGAACCAATTATGGAAAGAGG - Intergenic
1143712159 17:8742530-8742552 AAGGAGCCACACAGGGCGAGGGG - Intronic
1144319519 17:14100530-14100552 AAGGAGCCAGCTGTGGAAAGAGG + Intronic
1146551167 17:33781507-33781529 AAGGATCCACTTTTGGTGAATGG - Intronic
1148757919 17:49984262-49984284 CAGGAACCACTGATGGTGAGTGG - Intergenic
1153940744 18:9974349-9974371 AATGAGCCGCTTTTGGAGAATGG - Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1159676698 18:71293278-71293300 AAGAAGCCACTTCTAGAAAGTGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162796276 19:13089219-13089241 CGGGGGCCACTTCTGGAGAGAGG + Intronic
1163267203 19:16228380-16228402 ATGGTGCCACTTGTGGGGAGGGG + Intronic
1163856542 19:19706887-19706909 AAGGAGCCACTTTTTGTGAGAGG - Intergenic
1165920815 19:39296929-39296951 AAGGGGCCACTTAAGAAGAGGGG - Intronic
1166049991 19:40253068-40253090 AAAGAGCCACATATGGCTAGTGG - Intronic
1168304617 19:55428819-55428841 AAGGGGCCAGTGTTGGAGAGGGG + Exonic
1168492733 19:56823975-56823997 AAGGAGACACTTCTGTAGAAGGG - Intronic
925062574 2:904815-904837 AGGGAGCCACGTGTGGAGGGTGG + Intergenic
925122055 2:1427181-1427203 AAGGGGCCACATCTGGGGAGGGG + Intronic
926168014 2:10533718-10533740 AAGTACCCACTTTTGGAGACAGG - Intergenic
929079793 2:38110862-38110884 AAGTAGCCAGTTCTTGAGAGAGG - Intergenic
929586156 2:43116020-43116042 AAGGAGCAATTCAAGGAGAGAGG - Intergenic
930357190 2:50335915-50335937 AAAGACCCACTGTTGGAGAGGGG + Intronic
931900337 2:66781393-66781415 AAGGAGCAAGTTAAGGAGGGAGG + Intergenic
933765869 2:85708952-85708974 ATGGTGCCACTTTTGAAGAGTGG - Intergenic
933812289 2:86040317-86040339 AAGGGGCCATTTAATGAGAGGGG - Intronic
935203653 2:100879820-100879842 TAGCAGCCACTCAAGGAGAGAGG + Intronic
936596639 2:113854532-113854554 AAGGGGCCATCTATGAAGAGTGG - Intergenic
937319961 2:120955250-120955272 CAGGAGCACCTTAAGGAGAGGGG + Exonic
937356625 2:121201934-121201956 AAGGTGCCATCTCTGGAGAGGGG + Intergenic
938447378 2:131389427-131389449 AAGGTGCCGTTTATAGAGAGAGG + Intergenic
939965466 2:148606246-148606268 AAGGAGCCAGTGAAGCAGAGAGG + Intergenic
940842480 2:158599816-158599838 AAGAAGCCACATGTGGAGATAGG - Intronic
941036544 2:160575065-160575087 AAGGAGCCACTACTTGAGAGAGG - Intergenic
941501562 2:166284799-166284821 AAGGAGCCACGAATGCTGAGTGG + Exonic
942291536 2:174476654-174476676 AAGGGGCCAATTGTGGAGACTGG - Intronic
944898417 2:204189283-204189305 AAGGATCCACTTATAGTGAGGGG + Intergenic
945349368 2:208759185-208759207 AAGAAGACATTTATGGGGAGTGG - Intronic
1170804088 20:19614765-19614787 AAGGATCCACTTAGGAAAAGAGG - Intronic
1172100980 20:32483779-32483801 AAGGAGGCACCCAGGGAGAGGGG + Intronic
1173333106 20:42092059-42092081 AAGGAACAACTTTTGGGGAGAGG + Intronic
1173476949 20:43366248-43366270 CAGAAGACATTTATGGAGAGAGG + Intergenic
1173509257 20:43613314-43613336 AAGAAGCCCCTGATGGAGGGAGG - Intronic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1182569112 22:31222901-31222923 GAGGAGCCAGTGAGGGAGAGGGG + Intronic
1184872544 22:47250095-47250117 AAGGAGCCACCTTGGGGGAGAGG + Intergenic
1184936979 22:47731861-47731883 AAGGAGCAAGTTTTGGAGTGTGG - Intergenic
949486946 3:4548974-4548996 AAGGAGTCACTTTTCGGGAGGGG + Intronic
949867944 3:8562226-8562248 AAGGAGCCCCAGATGGAAAGAGG + Intronic
950179815 3:10903423-10903445 GAGGAGCAACTTGTGGGGAGGGG - Intronic
950482169 3:13250952-13250974 AGGGAGCCTCTTCTGGACAGAGG - Intergenic
952123276 3:30270072-30270094 ATGGAGAAACTTTTGGAGAGCGG + Intergenic
952129121 3:30338659-30338681 AAGGAGCAAAATATAGAGAGTGG - Intergenic
955497774 3:59553733-59553755 TAGGTGGCACTTTTGGAGAGGGG + Intergenic
955517772 3:59744825-59744847 AAGGAGCACACTATGGAGAGTGG + Intergenic
956305184 3:67816391-67816413 AAGGTCACAATTATGGAGAGAGG - Intergenic
956611694 3:71130336-71130358 AAAAAGCCTCTGATGGAGAGAGG + Intronic
956636120 3:71367233-71367255 AAGGAGCCTCTGCAGGAGAGAGG - Intronic
961570382 3:127793523-127793545 TAAGACCCACTTATGCAGAGGGG - Intronic
966436866 3:179896154-179896176 AAGAAGCCACTTGTGTATAGTGG + Intronic
968810858 4:2799152-2799174 AAGGAGCCACCTGTGGGGACAGG - Intronic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
969139101 4:5053329-5053351 AAGGAGCCAGTTGTGGACAGAGG + Intronic
969310899 4:6352642-6352664 GAGGAGCAAGTTATGCAGAGAGG + Intronic
972155862 4:36160993-36161015 AAGGAGCCAAAAATGGAGACAGG + Intronic
973173629 4:47176325-47176347 AAGGACACAGTTATTGAGAGAGG + Intronic
973646362 4:52954871-52954893 TAGGAGCCACTTCTTGAGGGAGG - Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
977595043 4:98869635-98869657 AAGTAGCCACATGTGGATAGTGG + Intergenic
979676219 4:123413054-123413076 GAGGAGCCAGTCATGGAAAGTGG + Intergenic
979777550 4:124609886-124609908 AAGGAGGAAGTTAGGGAGAGAGG + Intergenic
984225797 4:177033309-177033331 CAGCAGCCACTAGTGGAGAGGGG + Intergenic
986725823 5:10595618-10595640 AAGGAGTAACTGAAGGAGAGGGG + Intronic
989719216 5:44504629-44504651 AAGCAACCACTTAAGGAGATTGG + Intergenic
991943297 5:71875909-71875931 AAGGTGCCATTTATGGGGAAAGG + Intergenic
992409765 5:76493600-76493622 AAAGAGCCACCTATGGGGTGGGG - Intronic
994412363 5:99423233-99423255 AAGGAACCACTTTAGGATAGAGG + Intergenic
994481457 5:100342022-100342044 AAGGAACCACTTTAGGATAGAGG - Intergenic
997913149 5:137896284-137896306 AAGTAGCTGCTTCTGGAGAGTGG - Intronic
998054490 5:139062778-139062800 GACTAGCCACTTATGGAAAGAGG - Intronic
999352969 5:150894509-150894531 AATGAGCCACTTATAGGGATAGG + Exonic
999388962 5:151176113-151176135 CAGGAGCCACATATGCTGAGTGG + Intergenic
1001270721 5:170309675-170309697 AAGGAGCAAGTGAGGGAGAGAGG + Intergenic
1001325614 5:170721694-170721716 AAGGAGAAAATTATGGAGTGGGG - Intronic
1001534028 5:172486058-172486080 AAAGAGCCATTTATGGAGACTGG - Intergenic
1002978772 6:2113129-2113151 AAGGAGGAACTTTTGGAGTGGGG - Intronic
1003540841 6:7016802-7016824 AAAGACCCACTAATGGATAGAGG + Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1007899647 6:45399257-45399279 AAGAAGCCACTTTGGGAGATGGG - Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1012210554 6:96513093-96513115 CAGGAGCCAGTAATGCAGAGTGG - Intergenic
1012260186 6:97079532-97079554 AAGGAACCAATTAGGGAAAGAGG + Intronic
1012505105 6:99936459-99936481 AAGGAGCCAAGAATGGAGACAGG - Intronic
1013630426 6:111981003-111981025 GAAGGGCCACTTATGGAGAGGGG - Intergenic
1014230718 6:118899033-118899055 CAGGAGCCACTTTTGCAGGGAGG - Intronic
1014772086 6:125468319-125468341 AAGGAGCCAGTTCTGGAGCAAGG + Intergenic
1016068096 6:139704746-139704768 AAGGAGGCACGTGTGAAGAGGGG - Intergenic
1016640368 6:146341290-146341312 AAGGAGCCAATTCTAGAGAGAGG - Intronic
1016798900 6:148148156-148148178 ATAGAGCCATTTATGGAGATTGG + Intergenic
1017954427 6:159167253-159167275 AGGAAGCCACGCATGGAGAGCGG - Intergenic
1019566105 7:1679765-1679787 AGGGAGCCACTGTTGGAGTGTGG - Intergenic
1021806973 7:24367319-24367341 AAGGAGAGACATTTGGAGAGCGG + Intergenic
1022257623 7:28675052-28675074 AAGGAGCCACATATGGCTACAGG - Intronic
1022388442 7:29923365-29923387 AAGGAGCCAGGACTGGAGAGGGG + Intronic
1022838798 7:34142930-34142952 CAGTAGCCAAATATGGAGAGTGG + Intronic
1023138534 7:37077757-37077779 GAGGAGCCACAGGTGGAGAGAGG + Intronic
1023343848 7:39251208-39251230 AGGCAGCCTCTTCTGGAGAGGGG - Intronic
1024589430 7:50868266-50868288 TAGCATCCACTCATGGAGAGTGG - Intergenic
1030513385 7:110512962-110512984 AATAAGCCACTAATGGAGATAGG - Intergenic
1030561070 7:111086710-111086732 AATGAGTCACTGATGGTGAGGGG - Intronic
1032203537 7:129841464-129841486 CAGTAGCCACTTATGGCTAGTGG - Intronic
1034368155 7:150569945-150569967 CAGGGGCCAGTTATGGTGAGAGG + Exonic
1034760942 7:153671390-153671412 AAACAGCCACTTAGGGAGTGGGG + Intergenic
1034981799 7:155483874-155483896 ATGGAGCCTCTTCTGGAGGGAGG + Intronic
1039805155 8:40991462-40991484 AAGGAGCCCTTGAGGGAGAGAGG + Intergenic
1041694415 8:60720716-60720738 AAGGAGCCACTGCTGGTAAGCGG - Intronic
1048239887 8:132730948-132730970 AAGGCATCACTTATGGACAGGGG + Intronic
1048490091 8:134884365-134884387 AAGGAGCCACTTTGCAAGAGTGG - Intergenic
1051441875 9:17093475-17093497 AAGGAGGCATCTGTGGAGAGAGG - Intergenic
1053104613 9:35399093-35399115 AGGGAGCCCCTTGGGGAGAGGGG + Intronic
1055872861 9:80905163-80905185 AAGGAGCAACTTCTGCATAGGGG + Intergenic
1058708309 9:107655983-107656005 AAGGAGCATCTCAAGGAGAGGGG + Intergenic
1059437448 9:114285229-114285251 AAGGAGCCACCAAGGCAGAGGGG + Intronic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1061782120 9:133002532-133002554 AAAGAGCCACTTGGGTAGAGGGG - Intergenic
1062138459 9:134942325-134942347 AAGCAGCCTCTGCTGGAGAGGGG - Intergenic
1062280004 9:135747587-135747609 AAAGAGACACTTATGCAGGGAGG + Intronic
1187810513 X:23171255-23171277 AATGAGACACTTTTGGGGAGAGG + Intergenic
1189273810 X:39770446-39770468 AGGGTGCCAAATATGGAGAGAGG - Intergenic
1190154930 X:47982739-47982761 AAGCACCAACTTAAGGAGAGTGG + Intronic
1190267596 X:48836533-48836555 AAGGAGAGACATATGGGGAGAGG - Intergenic
1193797478 X:85893699-85893721 AAGGTGCCACTTATGAGGAAAGG + Intronic
1197953024 X:131918347-131918369 ACAGAGCCACTTCTGGGGAGTGG - Intergenic
1198315660 X:135463750-135463772 CAGGAGCCACATGTGGTGAGTGG - Intergenic