ID: 1182425247

View in Genome Browser
Species Human (GRCh38)
Location 22:30268137-30268159
Sequence CCTGAGCTGCTCCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182425232_1182425247 28 Left 1182425232 22:30268086-30268108 CCTCAGGAGTCTGGGGAGTCAGG No data
Right 1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG No data
1182425242_1182425247 -3 Left 1182425242 22:30268117-30268139 CCTGGAGGCTGCCAGGGAGGCCT No data
Right 1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG No data
1182425231_1182425247 29 Left 1182425231 22:30268085-30268107 CCCTCAGGAGTCTGGGGAGTCAG No data
Right 1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182425247 Original CRISPR CCTGAGCTGCTCCAGCTGGA GGG Intergenic
No off target data available for this crispr