ID: 1182426534

View in Genome Browser
Species Human (GRCh38)
Location 22:30276231-30276253
Sequence TTTGTTGGGCAAAGACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182426534_1182426543 13 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426543 22:30276267-30276289 AAGATGGTGGGAAGCGGCCAGGG No data
1182426534_1182426544 22 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426544 22:30276276-30276298 GGAAGCGGCCAGGGTCCCAGTGG No data
1182426534_1182426545 23 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426545 22:30276277-30276299 GAAGCGGCCAGGGTCCCAGTGGG No data
1182426534_1182426540 1 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426540 22:30276255-30276277 AGGCAACTGCAGAAGATGGTGGG No data
1182426534_1182426538 -3 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426538 22:30276251-30276273 AAAGAGGCAACTGCAGAAGATGG No data
1182426534_1182426542 12 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426542 22:30276266-30276288 GAAGATGGTGGGAAGCGGCCAGG No data
1182426534_1182426541 7 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426541 22:30276261-30276283 CTGCAGAAGATGGTGGGAAGCGG No data
1182426534_1182426546 24 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426546 22:30276278-30276300 AAGCGGCCAGGGTCCCAGTGGGG No data
1182426534_1182426539 0 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426539 22:30276254-30276276 GAGGCAACTGCAGAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182426534 Original CRISPR TTTGTTGGGCAAAGACTCTG AGG (reversed) Intergenic
No off target data available for this crispr