ID: 1182426540

View in Genome Browser
Species Human (GRCh38)
Location 22:30276255-30276277
Sequence AGGCAACTGCAGAAGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182426534_1182426540 1 Left 1182426534 22:30276231-30276253 CCTCAGAGTCTTTGCCCAACAAA No data
Right 1182426540 22:30276255-30276277 AGGCAACTGCAGAAGATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182426540 Original CRISPR AGGCAACTGCAGAAGATGGT GGG Intergenic
No off target data available for this crispr