ID: 1182427464

View in Genome Browser
Species Human (GRCh38)
Location 22:30282530-30282552
Sequence GGCTTTTTGGTTCTCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182427464_1182427467 -5 Left 1182427464 22:30282530-30282552 CCTCTACAGAGAACCAAAAAGCC No data
Right 1182427467 22:30282548-30282570 AAGCCAGCTGTGGAACCATTTGG No data
1182427464_1182427472 29 Left 1182427464 22:30282530-30282552 CCTCTACAGAGAACCAAAAAGCC No data
Right 1182427472 22:30282582-30282604 CCCAGCAGCCTCACCCACCTGGG No data
1182427464_1182427470 28 Left 1182427464 22:30282530-30282552 CCTCTACAGAGAACCAAAAAGCC No data
Right 1182427470 22:30282581-30282603 ACCCAGCAGCCTCACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182427464 Original CRISPR GGCTTTTTGGTTCTCTGTAG AGG (reversed) Intergenic
No off target data available for this crispr