ID: 1182427467

View in Genome Browser
Species Human (GRCh38)
Location 22:30282548-30282570
Sequence AAGCCAGCTGTGGAACCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182427464_1182427467 -5 Left 1182427464 22:30282530-30282552 CCTCTACAGAGAACCAAAAAGCC No data
Right 1182427467 22:30282548-30282570 AAGCCAGCTGTGGAACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182427467 Original CRISPR AAGCCAGCTGTGGAACCATT TGG Intergenic
No off target data available for this crispr