ID: 1182427472

View in Genome Browser
Species Human (GRCh38)
Location 22:30282582-30282604
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182427466_1182427472 16 Left 1182427466 22:30282543-30282565 CCAAAAAGCCAGCTGTGGAACCA No data
Right 1182427472 22:30282582-30282604 CCCAGCAGCCTCACCCACCTGGG No data
1182427468_1182427472 8 Left 1182427468 22:30282551-30282573 CCAGCTGTGGAACCATTTGGCAA No data
Right 1182427472 22:30282582-30282604 CCCAGCAGCCTCACCCACCTGGG No data
1182427464_1182427472 29 Left 1182427464 22:30282530-30282552 CCTCTACAGAGAACCAAAAAGCC No data
Right 1182427472 22:30282582-30282604 CCCAGCAGCCTCACCCACCTGGG No data
1182427469_1182427472 -4 Left 1182427469 22:30282563-30282585 CCATTTGGCAAGCATGCGACCCA No data
Right 1182427472 22:30282582-30282604 CCCAGCAGCCTCACCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182427472 Original CRISPR CCCAGCAGCCTCACCCACCT GGG Intergenic
No off target data available for this crispr