ID: 1182428420

View in Genome Browser
Species Human (GRCh38)
Location 22:30286814-30286836
Sequence CTACTCGCACAGGTGGACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182428420_1182428430 24 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428430 22:30286861-30286883 GCGATGGCTGGAAGCGTCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 67
1182428420_1182428426 -1 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428426 22:30286836-30286858 GAAGAGGACATCTATGAGGGTGG 0: 1
1: 0
2: 2
3: 10
4: 229
1182428420_1182428429 12 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428429 22:30286849-30286871 ATGAGGGTGGTGGCGATGGCTGG 0: 1
1: 1
2: 1
3: 32
4: 395
1182428420_1182428427 2 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428427 22:30286839-30286861 GAGGACATCTATGAGGGTGGTGG 0: 1
1: 0
2: 2
3: 15
4: 229
1182428420_1182428424 -5 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428424 22:30286832-30286854 AGTAGAAGAGGACATCTATGAGG 0: 1
1: 0
2: 0
3: 27
4: 182
1182428420_1182428428 8 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428428 22:30286845-30286867 ATCTATGAGGGTGGTGGCGATGG 0: 1
1: 0
2: 1
3: 19
4: 405
1182428420_1182428425 -4 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428425 22:30286833-30286855 GTAGAAGAGGACATCTATGAGGG 0: 1
1: 0
2: 0
3: 14
4: 184
1182428420_1182428431 25 Left 1182428420 22:30286814-30286836 CCAAGGTCCACCTGTGCGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1182428431 22:30286862-30286884 CGATGGCTGGAAGCGTCTCAGGG 0: 1
1: 0
2: 2
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182428420 Original CRISPR CTACTCGCACAGGTGGACCT TGG (reversed) Exonic
902642979 1:17778608-17778630 CTAGTCGCACAGCTGTACCTTGG + Intronic
902807901 1:18872300-18872322 CTACTGGCCCAGGTGGGTCTGGG + Exonic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
906581043 1:46935327-46935349 TTCCTAGCACAGGTGGACCCTGG - Intronic
906602681 1:47143567-47143589 TTCCTAGCACAGGTGGACCCTGG + Intronic
910903459 1:92148083-92148105 CCACTCACCCAGGTGGATCTGGG + Intergenic
916008084 1:160680034-160680056 CTACTCCCACATGTGGACTACGG - Intronic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
1065721418 10:28631587-28631609 CAGCTGGCACAGGAGGACCTGGG + Intergenic
1078404960 11:11062415-11062437 CTTTTCCAACAGGTGGACCTTGG + Intergenic
1088882599 11:113983335-113983357 CTCCTCGCTCAGGTGTCCCTGGG - Intronic
1098912676 12:76225667-76225689 CCACTCCCACAGTTGGTCCTTGG + Intergenic
1101672019 12:106884445-106884467 CTAGTGGCAGAGCTGGACCTGGG - Intronic
1106095214 13:26637437-26637459 TTACTCTCACAACTGGACCTTGG + Intronic
1106104438 13:26721896-26721918 CTCCTCGCATAGGAGGACCAGGG + Intergenic
1113789924 13:113022800-113022822 GTACTCGCACAGGAGGACACAGG + Intronic
1134320941 16:13162052-13162074 GTAATGGCAGAGGTGGACCTAGG + Intronic
1137867656 16:51917401-51917423 CTACTCACACCCCTGGACCTAGG + Intergenic
1145891038 17:28415981-28416003 CTTCTCTCAAAGGTGGAACTGGG + Intergenic
1154254310 18:12769278-12769300 CTACTCTGACTGGGGGACCTCGG - Intergenic
1160922171 19:1526145-1526167 ATTCTGGCACAGGTGGACCCAGG - Intronic
1162019350 19:7861641-7861663 CTACTCTCACAGGGTGTCCTAGG - Intronic
929545947 2:42855343-42855365 CAACTGGCCCAGATGGACCTGGG + Intergenic
931710002 2:64980712-64980734 CTACAGCCATAGGTGGACCTAGG - Intergenic
932259947 2:70318620-70318642 CCACTAGCACAGGTAGACCAAGG - Intergenic
938958219 2:136318233-136318255 AAACTCTCACAGGTGGAACTTGG - Intergenic
942959498 2:181813080-181813102 CTACTCACAAAAGTGAACCTGGG + Intergenic
945018820 2:205550245-205550267 CAACTCTCCCAGGTGGACTTTGG + Intronic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
1172483749 20:35286781-35286803 CTGCTCGCACGGCTGGAGCTGGG - Exonic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1177908133 21:26997304-26997326 TTGCTCCCACAGGTGGACCAGGG + Intergenic
1179520773 21:41942911-41942933 CCACGGGCACAGGTGAACCTTGG - Intronic
1182428420 22:30286814-30286836 CTACTCGCACAGGTGGACCTTGG - Exonic
950564739 3:13761821-13761843 CTACTGCCAAAGGTGGAACTGGG - Intergenic
950627285 3:14256817-14256839 CTCCTAGCAGAGGTAGACCTTGG + Intergenic
954403230 3:50330404-50330426 CTACACCCACAGGTGGACACAGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
957145818 3:76422413-76422435 CTACTTGAACAGGTGGGCCTGGG + Intronic
957673713 3:83339701-83339723 CCACTCCCACAGTTGGTCCTTGG - Intergenic
966373317 3:179271002-179271024 CTCCTCGCTCAGGAGGAGCTTGG + Intergenic
968901949 4:3436107-3436129 CCACACGGACAGGGGGACCTTGG + Intronic
986310192 5:6545598-6545620 CCACTCGCACTGGTGGAACTGGG - Intergenic
990699489 5:58460070-58460092 TCACTCGCACAAGTGGACCGGGG - Exonic
990953127 5:61318315-61318337 CTACTCAAGCAGTTGGACCTGGG - Intergenic
1002009275 5:176264147-176264169 CTACTCCCACAGGTGGGAGTTGG + Intronic
1002217448 5:177648136-177648158 CTACTCCCACAGGTGGGAGTTGG - Intergenic
1009003966 6:57758339-57758361 CTACTCTCATTGGTGGACCAAGG + Intergenic
1010641930 6:78339811-78339833 CTACTCTAACAGGGGGACCATGG - Intergenic
1020116629 7:5479915-5479937 TCACTGGCACAGGTGGATCTGGG - Intronic
1026896055 7:74010682-74010704 CTACTGGCATGGGTGGCCCTCGG - Intergenic
1028852120 7:95549711-95549733 AGACTCTGACAGGTGGACCTAGG + Intergenic
1034557122 7:151857338-151857360 CCCCTCTCACAGGCGGACCTGGG - Intronic
1047796618 8:128263411-128263433 CTACTTGCACAGCTGGGTCTAGG + Intergenic
1049339287 8:142103377-142103399 GTGCAGGCACAGGTGGACCTAGG - Intergenic
1053136053 9:35650744-35650766 CTACTCGCACTGGGTGAGCTGGG - Exonic
1060052592 9:120387923-120387945 ATATTTGCACAGGTGTACCTCGG - Intergenic