ID: 1182431608

View in Genome Browser
Species Human (GRCh38)
Location 22:30302176-30302198
Sequence CCTGCCTTAGGGAGGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182431594_1182431608 20 Left 1182431594 22:30302133-30302155 CCTCCTCAGCATAAAGGTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 188
Right 1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG 0: 1
1: 0
2: 2
3: 39
4: 347
1182431591_1182431608 30 Left 1182431591 22:30302123-30302145 CCCACTCTGGCCTCCTCAGCATA No data
Right 1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG 0: 1
1: 0
2: 2
3: 39
4: 347
1182431596_1182431608 17 Left 1182431596 22:30302136-30302158 CCTCAGCATAAAGGTGCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG 0: 1
1: 0
2: 2
3: 39
4: 347
1182431592_1182431608 29 Left 1182431592 22:30302124-30302146 CCACTCTGGCCTCCTCAGCATAA 0: 1
1: 1
2: 0
3: 26
4: 282
Right 1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG 0: 1
1: 0
2: 2
3: 39
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182431608 Original CRISPR CCTGCCTTAGGGAGGATGGT AGG Intronic
900288733 1:1914806-1914828 CCTGGCTTTGGGAGTCTGGTGGG + Exonic
900356402 1:2266935-2266957 TCTGCTTCAGGGAGGAAGGTGGG + Intronic
902375309 1:16027568-16027590 CCTCCTTCAGGGAGGATGGAAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
904309508 1:29619194-29619216 CCTACCTGAGGGTGGAAGGTGGG + Intergenic
904376199 1:30083945-30083967 CCTGGCTTTGGGATGGTGGTCGG + Intergenic
904627743 1:31816477-31816499 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
904866986 1:33587120-33587142 TCGGCGTTGGGGAGGATGGTGGG + Exonic
905586427 1:39122937-39122959 CCTACCTTAGAAAGGAGGGTGGG + Intronic
906522674 1:46476736-46476758 CCTGCCTTAGAGAGGACCCTTGG + Intergenic
907889051 1:58620565-58620587 CCTGCCTTAGGGATGACACTGGG - Intergenic
908314898 1:62922906-62922928 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
908686723 1:66728946-66728968 CCTGCTTGAGGGAGGAGGATGGG + Intronic
910098192 1:83548235-83548257 CCTGTCTGAGTGAGCATGGTGGG - Intergenic
910788412 1:91025236-91025258 CCCACCTGAGGGTGGATGGTGGG - Intergenic
910834005 1:91489171-91489193 CCTGCCTTGTGGAGGATCATGGG + Intergenic
911124883 1:94332187-94332209 CCTGCCTGAGGGTGGATGGTGGG + Intergenic
911571534 1:99523358-99523380 CCTGCCACAGGGTGGAGGGTGGG - Intergenic
913687498 1:121246797-121246819 CTTCCTTTTGGGAGGATGGTTGG + Intronic
914039360 1:144034442-144034464 CTTCCTTTTGGGAGGATGGTTGG + Intergenic
914150099 1:145033494-145033516 CTTCCTTTTGGGAGGATGGTTGG - Intronic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915547515 1:156609752-156609774 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
915565015 1:156708210-156708232 CCTGGCTGAGGGAGGTGGGTAGG + Intergenic
919191569 1:194227849-194227871 CCTACCTTAGGGTGGAGGGTGGG + Intergenic
919947832 1:202334371-202334393 CCTACCTGAGGGTGGAGGGTGGG + Intronic
920474826 1:206265317-206265339 CTTCCTTTTGGGAGGATGGTTGG + Intronic
921104813 1:211965784-211965806 CCTACCTGAGGGTGGAAGGTGGG + Intronic
921559541 1:216640441-216640463 CTTGCCTTAGGGAAGCTGGTTGG + Intronic
922206819 1:223455341-223455363 CTTCACTTAGGGAGGAAGGTAGG - Intergenic
922803639 1:228375020-228375042 CCAGCCTTGGGAAGGATGGCCGG + Intronic
923675613 1:236078448-236078470 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
924898410 1:248368402-248368424 CCTGCCTTATGGAGGTGGGAGGG + Intergenic
1064605612 10:17035829-17035851 CCTACCTGAGGGTGGAGGGTGGG + Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1065271263 10:24036129-24036151 CCTGGCTTAGGGATGATCTTTGG - Intronic
1067945550 10:50686101-50686123 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1068855987 10:61797957-61797979 CCTGCGCAGGGGAGGATGGTTGG - Intergenic
1068987814 10:63123244-63123266 CCTGCCTGAGGGTGGAGGGTAGG - Intergenic
1070867061 10:79712974-79712996 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1070880851 10:79851095-79851117 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1071602174 10:86963647-86963669 TCTGCCCCAGGGAGGATGTTAGG - Intronic
1071633975 10:87235197-87235219 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071647423 10:87367414-87367436 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1072294879 10:93999429-93999451 CCTGCCTTTGGGAGTAGTGTGGG - Intronic
1072784581 10:98270909-98270931 CCTGACTTAGGCAGGAAGGGAGG - Intergenic
1074222698 10:111453822-111453844 CCTCCCTTAGGGAGAAAGGGAGG + Intergenic
1074610278 10:115015037-115015059 CCTGTCTTAGGGAGTAGGGGTGG + Intergenic
1075559901 10:123460699-123460721 CCTGCCTTATGGAATATGGTGGG + Intergenic
1075707284 10:124509026-124509048 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1076481345 10:130786937-130786959 CCTGCCTTCAGGAGGGAGGTGGG + Intergenic
1076718854 10:132383864-132383886 TCTGCCTTTGGCAGGCTGGTGGG + Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1078007834 11:7545892-7545914 CCTACCTTGGGGAGGAGAGTGGG + Intronic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1079702921 11:23571723-23571745 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1081299333 11:41431387-41431409 CCTTCCTTAGGAAGGAAGGAAGG + Intronic
1081456443 11:43227934-43227956 CCAGCCTTATGGAGGATGTGGGG + Intergenic
1081565897 11:44261140-44261162 CCTAGCTGGGGGAGGATGGTTGG - Exonic
1082814423 11:57498902-57498924 AGTGACTTGGGGAGGATGGTGGG - Intronic
1083303483 11:61750995-61751017 ACTGCTTTAGGTAGGCTGGTTGG + Intergenic
1083762518 11:64826469-64826491 CCTGCATTAGGGAGGTTGCAGGG + Exonic
1084422200 11:69066045-69066067 CCTGCCTTAGGGAGTTCTGTCGG + Intronic
1084587209 11:70069177-70069199 CCTTGGTCAGGGAGGATGGTGGG - Intergenic
1084738556 11:71122490-71122512 CCTGTCTTAGTGTGGAGGGTTGG + Intronic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085693651 11:78686027-78686049 CCTGCCTTGGAGAGGAGGGCAGG - Intronic
1086303377 11:85453928-85453950 CCTGCTTAAGGGTGGAGGGTGGG - Intronic
1086329706 11:85741652-85741674 CCTGCCTTTGGGAGCAAGCTAGG + Intronic
1086611917 11:88767667-88767689 CCTACTTGAGGGTGGATGGTAGG + Intronic
1087224701 11:95585317-95585339 CCTACCTGAGGGAGGAGGATGGG + Intergenic
1087290526 11:96315751-96315773 CCTGGCTCAGAGAGGATGGTAGG - Intronic
1087842823 11:102937512-102937534 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1089786015 11:120907805-120907827 GCTGGCTTAGGGAGGATGGGTGG + Intronic
1090466741 11:126941761-126941783 CGTGCCCTGGGAAGGATGGTAGG + Intronic
1090718817 11:129454129-129454151 CCTACCAGAGGGAGGACGGTGGG - Intergenic
1090847969 11:130546394-130546416 CCGGCCTTGGGTAGAATGGTGGG + Intergenic
1091563894 12:1633831-1633853 CCTCTCTTAGGGAGGATACTTGG + Intronic
1091792436 12:3279557-3279579 CCTGGGTTCAGGAGGATGGTGGG + Intronic
1093030328 12:14282636-14282658 CCTACCTGAGGGCGGAGGGTGGG + Intergenic
1094255533 12:28421358-28421380 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1095555860 12:43503717-43503739 CCTACTTGAGGGTGGATGGTGGG - Intronic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1099220783 12:79911437-79911459 CCTACCTGAGGGTGGAGGGTGGG + Intronic
1099805720 12:87516489-87516511 CCTACCTGAGGGTGGATAGTGGG + Intergenic
1100251584 12:92830321-92830343 CCTGCTTGAGGGTGGAAGGTGGG - Intronic
1100394393 12:94171904-94171926 GCTGCCCTAGGGAGCCTGGTGGG - Intronic
1100714972 12:97295905-97295927 CCTGCCTTAGTGAAGATTTTAGG - Intergenic
1101353061 12:103950597-103950619 CCTGCCTTAGGGAGTATGGATGG + Exonic
1101409216 12:104455486-104455508 CCTTTCTTAGTGATGATGGTGGG + Intronic
1104537374 12:129630854-129630876 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1105024303 12:132838291-132838313 GCTGGCCTAGGGAGGAGGGTTGG + Intronic
1105465863 13:20639448-20639470 CCTGCCTGAAGGAGGAGGGAAGG + Intronic
1105976197 13:25475169-25475191 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1106048492 13:26168038-26168060 CCTACCTTAGGGTGGAGGGTGGG + Intronic
1106132764 13:26953242-26953264 CCTGCCTTAAGGAGAAGGGAAGG + Intergenic
1107116102 13:36747382-36747404 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1107703936 13:43080225-43080247 CCTACCTGAGGGTGGAGGGTAGG - Intronic
1107829138 13:44358812-44358834 CCTGCTTTAGGTAGCATGGAGGG + Intergenic
1108721221 13:53134792-53134814 ACAGCCTTAGGGATAATGGTTGG + Intergenic
1108782560 13:53854572-53854594 GCTGCTTTAGGGAGAATGTTTGG - Intergenic
1108883170 13:55146375-55146397 CCTGCTTCAGGGAGGAAGGCTGG + Intergenic
1109495030 13:63158374-63158396 CCTACATGAGGGTGGATGGTGGG - Intergenic
1109771763 13:66983862-66983884 CCTGCCTGAGGGTGGAGGGTGGG - Intronic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1111137459 13:84067005-84067027 CCTGATTTAGGGAGGATGAGAGG - Intergenic
1112006581 13:95258932-95258954 CCTGCCTGCGGGAGGCTGCTGGG + Intronic
1114170634 14:20269497-20269519 ACTGCCTTAGGGATGGAGGTGGG + Intronic
1114279342 14:21176810-21176832 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1116737871 14:48717174-48717196 CCTACCTGAGGGTGGAGGGTAGG - Intergenic
1117628521 14:57665261-57665283 CAGGCCTCAGGGAGGATGGGCGG - Intronic
1118964064 14:70562986-70563008 CCTACTGTAGGGAGTATGGTTGG - Intergenic
1119390274 14:74286945-74286967 CCTGCCTCAGGGAGAAGGATGGG + Intronic
1119959536 14:78838980-78839002 CCTGTCTCAGGGAGAATAGTGGG + Intronic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1122614525 14:103007924-103007946 CCTGCCTTAGGCAGGCAGGAGGG + Intronic
1123123775 14:105930198-105930220 CCTCCCCTAGGGATGAGGGTCGG + Intronic
1123814011 15:23958100-23958122 CCTACCTCAGGGTGGAAGGTGGG - Intergenic
1125090100 15:35780593-35780615 CCTTCCTGAGGGTGGAGGGTGGG + Intergenic
1126467912 15:48977249-48977271 CCTGCCTGAGGGTGGAGGGTGGG - Intergenic
1131021716 15:89104671-89104693 CCTGCCTTAGGGAGTTAGATGGG + Intronic
1132828554 16:1916807-1916829 CCTGCTGCAGGGAGGAGGGTAGG - Intronic
1132932053 16:2463920-2463942 CCTGCCTTTAGGAGAAAGGTGGG - Intronic
1133049244 16:3107372-3107394 CCAGCCTTAGGAAGGAAGGAAGG - Intergenic
1134536902 16:15033643-15033665 CCTGCCTTAGAGAAGAGGGCGGG + Intronic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1135312887 16:21419444-21419466 CCTGTCTTTGGGAGGAGTGTGGG - Intronic
1135365810 16:21851724-21851746 CCTGTCTTTGGGAGGAGTGTGGG - Intronic
1135446004 16:22519438-22519460 CCTGTCTTTGGGAGGAGTGTGGG + Intronic
1135533008 16:23270641-23270663 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1136069162 16:27777803-27777825 CCAGCCCTAAGGAGGATGGATGG + Intronic
1136323000 16:29499952-29499974 CCTGTCTTTGGGAGGAGTGTGGG - Intronic
1136384663 16:29916088-29916110 CCTGCATTAGTGTGGAGGGTAGG - Intronic
1136437684 16:30239920-30239942 CCTGTCTTTGGGAGGAGTGTGGG - Intronic
1137544011 16:49386596-49386618 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1137585598 16:49662393-49662415 CCTTCCTCTTGGAGGATGGTTGG - Intronic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1140018301 16:71210496-71210518 CCTACTTGAGGGAGGAGGGTGGG + Intronic
1140409746 16:74734531-74734553 CCTGCCTTAGAGAGAAGGGGAGG + Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1140481899 16:75266486-75266508 CCAGCCTCTGGGAGGACGGTGGG - Intronic
1141669993 16:85486650-85486672 CCTGCCCTGGCGAGGATGGTGGG + Intergenic
1141695159 16:85615595-85615617 CCTGCCTTGGGAAGGGAGGTCGG + Intronic
1142696566 17:1637058-1637080 CTGGCCTGAGGGAGGAGGGTAGG + Exonic
1143867427 17:9934287-9934309 CCTTCCTGAGGCAGGATGGTGGG + Intronic
1144664058 17:17090262-17090284 CCTGCCTTAGTGCGGCTGGTTGG - Intronic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1145202655 17:20960743-20960765 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1145869011 17:28258449-28258471 CCTGCCTTAGCCAGGATGTCTGG + Intergenic
1146129480 17:30259008-30259030 CCCTCTTTAGGGAGGATGTTAGG - Intronic
1146649312 17:34597038-34597060 CCTGCCTGAGGGAGGAGGCAGGG - Intronic
1146828795 17:36048156-36048178 CCTGCCAGATGGAGGGTGGTTGG - Intergenic
1146950237 17:36900381-36900403 CCTGCCTCTGGGAGCATGCTGGG + Intergenic
1147470005 17:40649785-40649807 CCTGCCTTTGGGATTATGGTGGG + Intergenic
1147801849 17:43096978-43097000 CCTACTTGAGGGAGGAAGGTGGG + Intronic
1148279799 17:46339039-46339061 CCTACCTGAGGGTGGAGGGTGGG + Intronic
1148302017 17:46556895-46556917 CCTACCTGAGGGTGGAGGGTGGG + Exonic
1150007677 17:61479723-61479745 CCCTCCTTGGGGAGGAGGGTGGG - Intronic
1150400213 17:64850435-64850457 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1151092860 17:71462526-71462548 CCTACCTTAGGGAGGACAATCGG + Intergenic
1151253590 17:72857132-72857154 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
1151322335 17:73359450-73359472 CACGCCTGAGGGAGTATGGTAGG + Intronic
1151360478 17:73585634-73585656 CAGGCCTGAGGGAGGATGGTGGG - Intronic
1151434601 17:74087109-74087131 CCTGCCTTGGGCAGAAGGGTGGG - Intergenic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1153775197 18:8447062-8447084 CCTACCTGAGGGCGGAGGGTGGG + Intergenic
1154118686 18:11633801-11633823 CCTGTCTTCGGGAGGAGTGTGGG - Intergenic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1156067546 18:33162581-33162603 CCTGCTTGAGGGTGGATGTTTGG - Intronic
1156361375 18:36387180-36387202 CCTGCTTGAGGGGAGATGGTGGG + Intronic
1157368386 18:47087538-47087560 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1158294880 18:55984789-55984811 CCTACCAGAGGGTGGATGGTGGG + Intergenic
1158688762 18:59641439-59641461 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1159060721 18:63511324-63511346 CTTTCCTTAGGGAGGATGCCTGG + Intergenic
1159573156 18:70143588-70143610 CCTGCCTGAGGGTGGGGGGTAGG + Intronic
1159950420 18:74478613-74478635 CCTGCTTTCTGGAGCATGGTGGG - Intergenic
1159972529 18:74671508-74671530 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1160394984 18:78564324-78564346 CCTGCCTTAGGGAGGGGAGGAGG - Intergenic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1162515570 19:11145381-11145403 CCTGCCTGAGGGAGGAGAGAGGG - Intronic
1163568550 19:18066500-18066522 CCTGGCTTGGGGAGGAAGGGAGG - Intronic
1163655914 19:18544643-18544665 CTTGCCTTGGGGAGGTTGGGAGG - Intergenic
1163819783 19:19489647-19489669 CCTGCCTGAAGGAAGAGGGTAGG - Intronic
1164509288 19:28884414-28884436 CCTGCTTGAGGGTGGAAGGTGGG - Intergenic
1164829373 19:31308968-31308990 CCGGCCTTGGGGAGGACGGCAGG - Intronic
1165348781 19:35265626-35265648 CTTGCCCTAGGGAGGAAGGAAGG + Intronic
1166228353 19:41411176-41411198 CCTGCCTTAGGGCAGAAGGATGG + Intronic
1166340577 19:42134513-42134535 CCTGCCTGAGAGAGGATAGAGGG + Intronic
1166565240 19:43760984-43761006 CCAGCCTTTGGGAGGCTGATGGG - Intergenic
1166741545 19:45117701-45117723 CCTGCCTTGGGTGGGATGGCTGG - Intronic
1167842556 19:52133873-52133895 CCTACCTCAGGGTGGAGGGTGGG - Intronic
1168706602 19:58473882-58473904 CCTGGCAATGGGAGGATGGTAGG + Intergenic
1168714438 19:58518767-58518789 CCAGTCTAAGGGAGGAGGGTAGG + Intronic
925931166 2:8709284-8709306 TCTGCCTTAGGGATGAAGGCTGG + Intergenic
931677076 2:64708027-64708049 CCTACTTAAGGGAGGATGTTGGG - Intronic
932827161 2:74952030-74952052 CCTGCTTGAGGGTGGAGGGTGGG + Intergenic
933461783 2:82597133-82597155 CATGCCATAGGGCTGATGGTGGG + Intergenic
933864517 2:86503923-86503945 CCTACCTGAGGGTGGAGGGTGGG + Exonic
935151850 2:100444254-100444276 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
935512737 2:103995853-103995875 CCTGCCTCAGGCATGGTGGTGGG - Intergenic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
938172120 2:129088505-129088527 CCTGCCTTATGGAGAATGTTCGG + Intergenic
938501165 2:131831873-131831895 GCTGCCTTAGGGAGGCCGGAAGG - Intergenic
939713699 2:145556653-145556675 CCTACCTGAGGGGGGAGGGTAGG - Intergenic
942908559 2:181213076-181213098 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
944058020 2:195543863-195543885 CCTACTTGAGGGTGGATGGTGGG + Intergenic
944277862 2:197860024-197860046 CCTACCTGAGGGTGGAGGGTGGG - Intronic
946039897 2:216774476-216774498 CCTGCCTCGGGGGTGATGGTTGG + Intergenic
946334787 2:219029491-219029513 CCTGCCTTTGGGACGCTGGTGGG - Exonic
947095381 2:226561202-226561224 GCTGCTTTAGGGAGGCAGGTTGG - Intergenic
948118006 2:235507950-235507972 CCTGCTTGAGGGTGGAGGGTGGG - Intronic
948415004 2:237796733-237796755 CCATCCTTAGGGAGGATTATTGG - Intronic
948746050 2:240095252-240095274 ACTGACTTGGGGAGGGTGGTGGG + Intergenic
1169346506 20:4832793-4832815 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1169514675 20:6303046-6303068 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1170143246 20:13146268-13146290 TCTGCTTGAGGGAGGAGGGTGGG + Intronic
1173130007 20:40383330-40383352 GCTGCAGTATGGAGGATGGTGGG + Intergenic
1173146395 20:40528369-40528391 CCTGCCTGAGGGTGGAGTGTGGG - Intergenic
1173797802 20:45874769-45874791 CCTGCCTCAGGGTGAATTGTTGG + Intronic
1176512571 21:7759765-7759787 CCTGACAAAGGGAGGATGGTAGG - Intronic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1177019037 21:15829309-15829331 CCTACATTAGGGTGGAGGGTGGG - Intronic
1178254904 21:31043692-31043714 CCTTCCTTAGGGCGGATCCTAGG - Intergenic
1178356393 21:31913370-31913392 TCTGCCCGAGGGATGATGGTGGG + Intronic
1178641577 21:34348879-34348901 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1178646684 21:34390289-34390311 CCTGACAAAGGGAGGATGGTAGG - Intronic
1179170644 21:38970354-38970376 ACTGCCTTATGCAGGGTGGTGGG + Intergenic
1179466263 21:41575950-41575972 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1180127553 21:45802607-45802629 CCGGGCTGGGGGAGGATGGTGGG + Intronic
1182287654 22:29257878-29257900 CATGCCTTAGGGAGCGTGGGAGG - Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1183189669 22:36313826-36313848 CCAGCCTTCAGGAGGATGCTGGG + Intronic
1183758350 22:39791885-39791907 CCTACTTGAGGGAGGAGGGTGGG - Intronic
1184630455 22:45774174-45774196 CCTGCCTTAGTAGGCATGGTGGG + Intronic
1185052268 22:48560044-48560066 GCTGCCTGATGGAGGATGGCCGG - Intronic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
951236693 3:20244529-20244551 CCTACCTTAAGGTGGAAGGTGGG + Intergenic
951259215 3:20486732-20486754 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
952285012 3:31960075-31960097 CCTGCCTCAGGGAGTTTGGAAGG - Intronic
953666375 3:44929023-44929045 CCTGCCATGGGGGGGATGGAAGG + Intronic
954193586 3:48982644-48982666 CCTGCCTTTGGGAGTGTGGAGGG + Intronic
958606027 3:96359737-96359759 CCTGCCAGAGGGTGGAAGGTGGG + Intergenic
959301693 3:104610533-104610555 CCTACCTGAGGGTGGATGATGGG + Intergenic
959458989 3:106601022-106601044 AGTGCTTTAGGAAGGATGGTAGG + Intergenic
962695458 3:137943273-137943295 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
963063395 3:141242806-141242828 CCTGCCTCAGGGGGCATGGAGGG - Intronic
963882851 3:150547273-150547295 CCTGCCTTAATGAGGTTTGTAGG + Intronic
963982602 3:151556696-151556718 CCAGCCTTTGAGAGGATGGTAGG + Intergenic
964430381 3:156599574-156599596 CCTGCCTTGGGGAGCATGAAGGG - Intergenic
967744996 3:193045382-193045404 CCTACCTGAGGGTGGAGGGTAGG + Intergenic
968817428 4:2829269-2829291 GCTGCCATAGGGAGGATGAATGG + Intronic
968869202 4:3232957-3232979 CCCTCCTCAGTGAGGATGGTGGG + Intronic
969390396 4:6888362-6888384 CGTCCGTTGGGGAGGATGGTGGG + Intergenic
970887335 4:21001490-21001512 CCTGCCTAATAGAGGAAGGTGGG + Intronic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
972724641 4:41736095-41736117 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
972804385 4:42513173-42513195 CCAGGCTAAGGGAGAATGGTAGG - Intronic
973116006 4:46460202-46460224 CCTGCCTGAGGGTGGAGGGAGGG - Intronic
974239763 4:59231665-59231687 CCTACCTGAGGGTGGACGGTGGG - Intergenic
976045067 4:80936628-80936650 CCTACCTGAGGGTGGAGGGTGGG + Intronic
977535135 4:98248799-98248821 CCTGCTTTAGTGGAGATGGTGGG - Intergenic
978358616 4:107904603-107904625 CCTGCAGTAGGGAGAATAGTGGG + Intronic
979082861 4:116364080-116364102 CCTGTCTGAGGGTGGAAGGTGGG - Intergenic
979224551 4:118269430-118269452 CCTACCTGAGGGCGGAGGGTGGG - Intergenic
980342675 4:131570302-131570324 CCTGCCTTAGAGAGGAAGGGAGG - Intergenic
981062770 4:140444369-140444391 CTTACTTGAGGGAGGATGGTAGG - Intronic
981907602 4:149940162-149940184 CCTACCTTATGGTGGAGGGTGGG + Intergenic
982633950 4:157868499-157868521 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
984396456 4:179207664-179207686 CCTACCTGAGGGTGGATGATGGG - Intergenic
986620896 5:9673134-9673156 CCTACTTAAGGGTGGATGGTGGG + Intronic
987394521 5:17409694-17409716 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
988097996 5:26642468-26642490 CCTACTTGAGGGTGGATGGTGGG + Intergenic
988209072 5:28179064-28179086 CCTATCTGAGGGTGGATGGTGGG + Intergenic
989170393 5:38467031-38467053 CCTGTCCTAGGGAGGAAGGATGG + Intergenic
989618421 5:43360420-43360442 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
990348713 5:54894415-54894437 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
990492359 5:56314967-56314989 CCTGCCTTAGGGCAAAAGGTTGG - Intergenic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
990611321 5:57459607-57459629 CCTGCTTGAGGGAGGATAGTAGG + Intergenic
990663776 5:58049054-58049076 CCTGCCAAAGGGGGGAGGGTAGG - Intergenic
991455636 5:66800535-66800557 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
992507978 5:77406687-77406709 CCTGCCTCAGAGGGGGTGGTAGG + Intronic
993273929 5:85831841-85831863 CCTGCTTGAGGGTGGAAGGTGGG + Intergenic
994348257 5:98714337-98714359 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
995062962 5:107831350-107831372 CCTGCCTGAGAGAGAATGGCCGG + Intergenic
995637563 5:114211553-114211575 CCTACCTGAGGGAGGAGGGTGGG + Intergenic
996531210 5:124528964-124528986 CTTGCCTTGGAGAGGATGCTGGG + Intergenic
996953810 5:129159726-129159748 CCTACCTGAGGGTGGAGGGTAGG - Intergenic
999567378 5:152879822-152879844 CCTGCTTGAGGGTGGAGGGTAGG + Intergenic
999593667 5:153177851-153177873 CCTACCTGAGGGTGGAGGGTAGG + Intergenic
1002008713 5:176258841-176258863 ACTGTCTTTGGGAGGTTGGTGGG + Intronic
1002218009 5:177653411-177653433 GCTGTCTTTGGGAGGTTGGTGGG - Intergenic
1002269010 5:178057443-178057465 CCTACTTTAGGGTGGAGGGTGGG - Intergenic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1003080557 6:3017615-3017637 CCTGCCAAAGGGAAGGTGGTGGG + Intronic
1004164448 6:13243747-13243769 CCTGCATGAGGGTGGAGGGTAGG - Intronic
1006012369 6:31053856-31053878 CCTGCCTGGGGGATGATGCTTGG - Intergenic
1007509069 6:42361767-42361789 GCTGCCTGAAGGAGGATGGAGGG - Intronic
1008042882 6:46820500-46820522 CCTGCCTCAGGGAGGCAGATGGG + Intronic
1008313445 6:50007726-50007748 CCTTCCTTAGTGAGGATTTTGGG + Intergenic
1010187420 6:73159339-73159361 CCTACTTGAGGGTGGATGGTGGG + Intronic
1010260063 6:73805395-73805417 CCTGCCTTAGGGCTGGAGGTGGG - Intronic
1011970849 6:93220735-93220757 CCTTCCTGAGGGTGGAGGGTGGG + Intergenic
1013461466 6:110378699-110378721 CCTCCCTCAGGGAGTTTGGTAGG - Intergenic
1014894559 6:126886143-126886165 GCTGCCTTTGGGATGATTGTTGG - Intergenic
1015358153 6:132304992-132305014 CCTGCCCTCGGGAGTTTGGTAGG - Intronic
1015565601 6:134567335-134567357 CCTGCTTTAGTAAGGATGGAAGG + Intergenic
1015577970 6:134692823-134692845 CTTGCCATATGGGGGATGGTGGG + Intergenic
1015943870 6:138479528-138479550 CATGTCTTAGGCAGGATGGAGGG + Intronic
1016287927 6:142493960-142493982 CCTCCCTGAGGGAGGAGGGTGGG + Intergenic
1017611638 6:156193045-156193067 CCTACCTGAGGGAGGAGGGTGGG - Intergenic
1018726466 6:166616650-166616672 CCTGGCAGAGGGAGGATGGATGG - Intronic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019780075 7:2934474-2934496 CCTGCGCTGGGGCGGATGGTAGG + Exonic
1019793235 7:3031044-3031066 CCTCCCTGAGGGTGGAGGGTGGG - Intronic
1020816997 7:12917825-12917847 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1028358043 7:89933432-89933454 TCTGCCTTACGGAGGAGGGTAGG + Intergenic
1028671320 7:93403480-93403502 CCTGCCAGAGGGTGGAAGGTGGG - Intergenic
1029438255 7:100574239-100574261 CCGGCCTTAGGGGTGAAGGTGGG - Intronic
1030807922 7:113938730-113938752 CCTGCTTGAGGGTGGAGGGTAGG - Intronic
1031429285 7:121646787-121646809 CCTTCTTTAGGGTGGAGGGTGGG - Intergenic
1034366654 7:150555527-150555549 CCTACCTTAGGGTGGAGGATGGG + Intergenic
1034422863 7:150998475-150998497 CCTGCCTTGGGGAAGAAGGCTGG - Intronic
1035076419 7:156180630-156180652 GCAGCCTCAGGGAGGAGGGTGGG + Intergenic
1037323773 8:17668825-17668847 CCTGCCTGAGGGTGGAGGGCGGG - Intronic
1037404054 8:18522821-18522843 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1039480952 8:37872898-37872920 TCTGCCTTAGGGAGCAAGGGTGG + Exonic
1039793526 8:40893820-40893842 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1041221392 8:55655156-55655178 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1041914036 8:63121690-63121712 CCTCCTTGAGGGAGGAGGGTGGG - Intergenic
1042703986 8:71647389-71647411 CCTGCCTGAGGGTGGAAAGTGGG + Intergenic
1044487621 8:92770969-92770991 CCTACCATGGGGAGAATGGTGGG - Intergenic
1045010924 8:97957743-97957765 CCTTCCCCAGGGAGGATTGTGGG + Intronic
1046024685 8:108708028-108708050 CCTACTTTAGGGTGGATGGTGGG - Intronic
1048071129 8:131022270-131022292 CCTGCCTGGGGGTGGAGGGTAGG - Intronic
1050327941 9:4515829-4515851 CCTGGCCTTGGGAGGAAGGTAGG - Intronic
1051949567 9:22615362-22615384 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1055314155 9:75016709-75016731 CCTCTCTTAGAGAGGATGTTCGG - Intronic
1055369888 9:75586217-75586239 CCTCCCTGAGGGTGGAGGGTGGG + Intergenic
1057353377 9:94317954-94317976 CCTGCTTTAGGGAGGCTTCTCGG - Intergenic
1057408041 9:94791332-94791354 CCTGCTTGAGGGTGGAGGGTGGG + Intronic
1057654374 9:96939638-96939660 CCTGCTTTAGGGAGGCTTCTCGG + Intronic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1057696532 9:97326675-97326697 CCTGCCTTCTGGAGTCTGGTTGG - Intronic
1058947200 9:109868861-109868883 CATTCCTGAGGGAGGATGGAGGG + Intronic
1059895916 9:118864958-118864980 CCTACCTAAGGCAGGAGGGTAGG - Intergenic
1062209171 9:135354092-135354114 TCTGCGTTAGGGATGATGGAGGG - Intergenic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1186012481 X:5150504-5150526 CCTGCTTGAGGGTGGAGGGTGGG - Intergenic
1186018491 X:5226627-5226649 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1186059665 X:5690599-5690621 CCTGTCATAGGGTGGAGGGTGGG + Intergenic
1186373295 X:8968632-8968654 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1186696400 X:12037730-12037752 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1187793508 X:22976946-22976968 CCTACTTGAGGGAGGAGGGTGGG + Intergenic
1188395244 X:29674717-29674739 CCTACCTGAGGGTGGAAGGTGGG - Intronic
1188866497 X:35319624-35319646 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1188879352 X:35472723-35472745 CCTGCTTGAGGGTGGAGGGTAGG - Intergenic
1189720656 X:43912919-43912941 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1190532106 X:51388917-51388939 CCTACTTGAGGGAGGAAGGTGGG + Intergenic
1190934400 X:54983322-54983344 CCTACCTGAGGGTGGAGGGTGGG - Intronic
1191046240 X:56140595-56140617 CCTACTTGAGGGTGGATGGTGGG + Intergenic
1191891109 X:65942310-65942332 CCTACTTGAGGGTGGATGGTGGG - Intergenic
1191983306 X:66950081-66950103 CCTACCTGAAGGTGGATGGTGGG + Intergenic
1193308781 X:79980533-79980555 CCTACTTTAGGGTGGAGGGTGGG - Intergenic
1193558804 X:82991756-82991778 CCTGCCTGAGGGTGAATGGTAGG - Intergenic
1193602840 X:83529547-83529569 CCTGCCTTTGGGAAAATGGTTGG + Intergenic
1195288808 X:103411741-103411763 CCTACCTGAGGGTGGAGGGTGGG - Intergenic
1195672211 X:107479246-107479268 CCTGCCTTAGGGAGCTGGGAAGG + Intergenic
1196584562 X:117415003-117415025 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1196964982 X:121045673-121045695 CCTACCAGAGGGAGGAGGGTGGG + Intergenic
1197474716 X:126906755-126906777 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1198819014 X:140625364-140625386 CCTACCTGAGGGTGGAGGGTGGG + Intergenic
1199000264 X:142628169-142628191 CCTACCTTAGGGTGGATAGCAGG - Intergenic
1199093603 X:143716828-143716850 CCTGCTGTAAGCAGGATGGTGGG - Intronic
1199214732 X:145251332-145251354 CCTGCTGTAAGCAGGATGGTGGG + Intronic
1199871319 X:151901326-151901348 GCTGCTTTAGCGAGGATGCTAGG - Intergenic
1200001927 X:153066577-153066599 CCTGCCTGAGGTAGGACGGTAGG + Intergenic
1200005805 X:153083448-153083470 CCTGCCTGAGGTAGGACGGTAGG - Intergenic
1200875941 Y:8154966-8154988 CCTTCCTTGTGGAGGATGTTAGG - Intergenic
1201386555 Y:13446166-13446188 CCTACTTGAGGGTGGATGGTGGG + Intronic