ID: 1182435557

View in Genome Browser
Species Human (GRCh38)
Location 22:30327209-30327231
Sequence TCCGGCTCGCGCTCTGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182435557_1182435562 -2 Left 1182435557 22:30327209-30327231 CCTACTGCAGAGCGCGAGCCGGA No data
Right 1182435562 22:30327230-30327252 GAGGCCCAGGGCTTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182435557 Original CRISPR TCCGGCTCGCGCTCTGCAGT AGG (reversed) Intergenic