ID: 1182441758

View in Genome Browser
Species Human (GRCh38)
Location 22:30368721-30368743
Sequence AGCTTTTTGCAGATGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182441758_1182441761 -3 Left 1182441758 22:30368721-30368743 CCCTCCTGCATCTGCAAAAAGCT 0: 1
1: 0
2: 4
3: 17
4: 235
Right 1182441761 22:30368741-30368763 GCTAAGTTCACTCATCTTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182441758 Original CRISPR AGCTTTTTGCAGATGCAGGA GGG (reversed) Intronic
901892540 1:12279842-12279864 AGCCTTTTTCATATGGAGGAGGG + Intronic
903024370 1:20416931-20416953 AGCTTTTGTCAGGGGCAGGAAGG - Intergenic
903336198 1:22626376-22626398 AGCTTTTTGCAGGAGCAGGAGGG + Intergenic
905329356 1:37181534-37181556 AGCTTGTTGAAGAGGCAGGGAGG - Intergenic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
908759396 1:67498112-67498134 TGCACTTTGCAGATGGAGGAAGG + Intergenic
909037723 1:70613283-70613305 AGCTTTGGGGAGATGAAGGAAGG + Intergenic
910851041 1:91650131-91650153 AGCTTTTTGCAGCTTCAGGCTGG - Intergenic
911681905 1:100726518-100726540 AGATTTTGCCAGATGAAGGAAGG - Intronic
913115532 1:115692811-115692833 GGTTTGTTGCAGATACAGGAAGG - Exonic
917156367 1:172003929-172003951 AGCTTGGTGCAGATGCACTATGG - Intronic
918062003 1:181069964-181069986 CTCTTTTTGCACAGGCAGGAGGG + Intergenic
918105666 1:181413378-181413400 AACTTCTTCCAGGTGCAGGAGGG + Intronic
919395904 1:197047276-197047298 AGCTCTTTGTAGATTCTGGATGG - Intronic
923678444 1:236100140-236100162 GGATTGTTGCAGATGGAGGAGGG - Intergenic
1062902988 10:1159632-1159654 CGCTTTATGCAGATGAGGGATGG + Intergenic
1063687983 10:8256794-8256816 AGCCTTTGGCAGATCCAGGCTGG - Intergenic
1063777305 10:9278583-9278605 AGCTTTTAGCAAATGAAGGAAGG + Intergenic
1063833813 10:9988184-9988206 AGCTATTTGAAAAAGCAGGACGG + Intergenic
1065369582 10:24970411-24970433 AGATATTTGCATATCCAGGAAGG + Intergenic
1065890366 10:30116230-30116252 AGCCCTTTGCAGATGCCAGAGGG + Intergenic
1068198994 10:53758343-53758365 AGCTTTTTGCTCATGCAGCTGGG + Intergenic
1069359522 10:67625736-67625758 TGCTTTTTGCAGATCCTAGATGG - Intronic
1070411970 10:76150131-76150153 AGCCATTTGCAGACACAGGAGGG - Intronic
1070668713 10:78363200-78363222 AGCTCCTGGCGGATGCAGGATGG - Intergenic
1071824859 10:89315450-89315472 TGCTTTGTGCAGCTACAGGATGG + Intronic
1072271903 10:93784758-93784780 AGATCTTTGCAGAGGAAGGAGGG + Intronic
1073719832 10:106155500-106155522 AGCTTTCTTCAAATGCAGGAAGG + Intergenic
1073864956 10:107791593-107791615 AGCTTCCAGCTGATGCAGGAAGG + Intergenic
1076106473 10:127827475-127827497 AGTTTTCTGCAGATTCAGGAGGG + Intergenic
1078011833 11:7578346-7578368 AGTGTTTTTCAGAGGCAGGAAGG + Intronic
1078879110 11:15430500-15430522 AACTTTATGCAGATGCAGCCCGG - Intergenic
1081627020 11:44662179-44662201 AGGTTCTTGCAGTTTCAGGAAGG + Intergenic
1082083914 11:48033414-48033436 AGCTTTTTGAAGCTGTGGGACGG + Intronic
1083050129 11:59769590-59769612 AGCTTTGTGCAGATGTAGCCAGG - Intronic
1083311216 11:61784716-61784738 AGGTGTCTGCAGAAGCAGGAAGG + Intronic
1083369604 11:62167649-62167671 ACCTTTTTGCACATGGAGGTGGG + Intergenic
1085376951 11:76072495-76072517 TGCCTTTTTCAGATGCATGAAGG + Intronic
1085502522 11:77037164-77037186 AGGTTTTTCCAGCTGCGGGAGGG + Intronic
1086049558 11:82573768-82573790 AGCATTTTGCAGATGTATGTAGG - Intergenic
1087609994 11:100422644-100422666 AGCTTTCTGCAGCTGCTGTAGGG - Intergenic
1089829007 11:121308493-121308515 ATCTTTTTGCAGAGGAAGTAGGG - Exonic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1091108336 11:132943310-132943332 AGCTCTTTTTGGATGCAGGAGGG - Exonic
1092569951 12:9710601-9710623 AGGTTTTTGCAGGCACAGGATGG - Intergenic
1093978578 12:25450928-25450950 AGCTTTTTCCATATGCTGGTTGG - Intronic
1096638477 12:52975989-52976011 ACCTTGATGAAGATGCAGGATGG - Intergenic
1097277133 12:57821304-57821326 GGCTTCATGCAGATGCAGCAGGG + Exonic
1099569313 12:84295595-84295617 AGCTTTTTGAAGATAAAGAATGG - Intergenic
1102620941 12:114193934-114193956 AGCACTTTGAAGATGGAGGAAGG + Intergenic
1102636204 12:114326510-114326532 AGCTTATTGCTGAGGAAGGAGGG - Intergenic
1102963344 12:117107929-117107951 TGCTGTTTGAAGATGAAGGAAGG + Intergenic
1106045563 13:26137184-26137206 AGCCTCTTCCTGATGCAGGAGGG + Intronic
1108618704 13:52160109-52160131 AGCTATTTGAAGGTGGAGGAAGG + Intergenic
1108771827 13:53711858-53711880 AGCTTGTTACAAATGCAGAATGG + Intergenic
1109045308 13:57403505-57403527 AGCATTTTTCAGAAGGAGGAAGG + Intergenic
1110127105 13:71958335-71958357 AGCTTCCTGCAGATGCAAAAGGG - Intergenic
1110240827 13:73264854-73264876 AGATTTTGCTAGATGCAGGAAGG + Intergenic
1110318974 13:74138471-74138493 AGCTGTTTGCAGTTATAGGAAGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1112360167 13:98710136-98710158 TGCTTTGTGCAGCTTCAGGAGGG - Intronic
1113031373 13:105997398-105997420 AGGTTGGTGCAGATGCAGGAAGG - Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1115355762 14:32445163-32445185 GGCTTGTTACAGATGCAGGAAGG - Intronic
1117109700 14:52438439-52438461 ACCTTTTGGCTGATGAAGGAGGG - Intronic
1118436195 14:65772859-65772881 TTCTTTTTGAAGAAGCAGGAGGG + Intergenic
1118779028 14:68993810-68993832 AGCTTGTTGCAAATGGAAGATGG + Intergenic
1118972127 14:70645798-70645820 AGCTTTGTGTAGAAGGAGGATGG - Intronic
1121535908 14:94690571-94690593 AGCTTCCTGCAGGTGAAGGATGG - Intergenic
1122881598 14:104692845-104692867 AGCTTTTCCCAGAGGCAGCAGGG + Intronic
1122931521 14:104934926-104934948 AGCTTGCTGCAGATGCTGCAGGG + Exonic
1123436351 15:20257323-20257345 CGCTATTGGCAGATGCAGGCTGG - Intergenic
1126466388 15:48964859-48964881 AGATTTATGAAGATGCAGAAAGG - Intergenic
1126630835 15:50733258-50733280 AGCTTTATGCAGCTTCAGGTAGG - Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1129204378 15:74027122-74027144 ACCTTTTTGCAGCTGCATAATGG + Intronic
1130539104 15:84809188-84809210 AGCTCTTTGCCTATGGAGGAGGG + Intergenic
1135569289 16:23535896-23535918 AGCTACTTGCAACTGCAGGAGGG + Intronic
1135620214 16:23949417-23949439 AGCTCTTTGGAGAAGCAGGTTGG + Intronic
1136552158 16:30987570-30987592 GGTTCTTTGCAGATGCAGGCTGG + Intronic
1137745712 16:50818693-50818715 AGCTTATTCCAGATACAGCAAGG + Intergenic
1137837200 16:51604064-51604086 AGCTTTTTGCATAGGCACGTTGG + Intergenic
1139021301 16:62753157-62753179 AGCTTTTGACAGCTGAAGGATGG - Intergenic
1140859862 16:79009273-79009295 TGCTCTTTGCAGATGAATGAAGG + Intronic
1142274349 16:89108658-89108680 AGCTTCTTTCACTTGCAGGATGG + Intronic
1142982031 17:3677906-3677928 AGCTTTTTGCTGAGTGAGGAGGG - Intronic
1144282251 17:13737825-13737847 AAATTTATGGAGATGCAGGAAGG + Intergenic
1145819242 17:27818594-27818616 TGCCTTTTGCAGATGCAGAGTGG + Intronic
1151005805 17:70434811-70434833 AGCTCTTTGAAGGTGGAGGAAGG - Intergenic
1151735571 17:75938079-75938101 AGATCTTTGGGGATGCAGGATGG + Intronic
1203169713 17_GL000205v2_random:136499-136521 AGCCTTGGGGAGATGCAGGAAGG - Intergenic
1154025142 18:10699750-10699772 AGCTTTTGGCAGATGGACTAAGG + Intronic
1157601875 18:48897844-48897866 AGCATCCTGCAGAGGCAGGAGGG - Intergenic
1161588611 19:5118592-5118614 AGCTTTTTGGAGATGCGGAGGGG - Intronic
1165880598 19:39040044-39040066 AACTATGTGCAGATTCAGGAAGG - Intergenic
1166515669 19:43444968-43444990 AGCTGTTGGTAAATGCAGGATGG + Intergenic
1167858843 19:52266760-52266782 AGCTTTATTCAGAAGCAGGGGGG - Intergenic
925336193 2:3100967-3100989 AGCTCTTTGCAGACAGAGGATGG + Intergenic
926660839 2:15464380-15464402 ATCTTATTACAGATGCAGGTAGG - Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929457139 2:42074041-42074063 TGCTTTTTGCGTATCCAGGAAGG - Intergenic
929571908 2:43028009-43028031 TGCTCTTTGAAGATGGAGGAAGG - Intergenic
929572822 2:43033370-43033392 TGCTCTTTGAAGATGGAGGAAGG + Intergenic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
932038583 2:68274166-68274188 AGCTCTATGCAGTTCCAGGAGGG + Intergenic
934861779 2:97769741-97769763 AGGTTTCTGCAGAACCAGGAAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938706835 2:133938846-133938868 AGCTTTGCGGAGAGGCAGGAGGG - Intergenic
938761440 2:134430075-134430097 TCCTCTTTGCAGCTGCAGGAAGG - Intronic
939731770 2:145793491-145793513 AGGTTTTTGCAGAGACTGGAGGG + Intergenic
939774852 2:146371970-146371992 AGCTTTTTGCATATGCTTGTAGG + Intergenic
939798720 2:146680528-146680550 AACATTTTGCAGGGGCAGGAGGG + Intergenic
940218818 2:151329190-151329212 AGCCTTCTGCAGAAGAAGGAGGG - Intergenic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946817203 2:223591348-223591370 AGTGTATTGCAGATGCAGGTAGG + Intergenic
948072327 2:235137958-235137980 AGCTTTCTGCAGTTGCTGAAAGG + Intergenic
948076214 2:235167202-235167224 AGATCTTTGCAGAGGCAGAAAGG - Intergenic
1168919739 20:1521402-1521424 AGCATTATGCAGAAGGAGGATGG + Intergenic
1169605706 20:7316501-7316523 TGCTTTTTTCAGATGCAGCCTGG + Intergenic
1170389207 20:15853653-15853675 AGTTCCTTGCAGTTGCAGGATGG - Intronic
1171197271 20:23209656-23209678 AGCTTATGGCAAATGCAAGAAGG + Intergenic
1172551973 20:35808165-35808187 AGTTGTTTGCAGATACATGATGG - Intronic
1172626555 20:36350768-36350790 TCCCTTTTGCAGATGCTGGAGGG + Intronic
1172848411 20:37944144-37944166 GGCTTCGGGCAGATGCAGGACGG - Exonic
1172895906 20:38299931-38299953 AGCTTGTGGTAGATGCTGGAGGG - Intronic
1173894726 20:46542010-46542032 ACCATTTTGCAGATGAAGGCAGG - Intronic
1174009621 20:47439147-47439169 AGCTGTTTCCAGAAGGAGGAGGG - Intergenic
1174909910 20:54596350-54596372 AAGTTTTTGCAGATGCATGTTGG - Intronic
1175400039 20:58694672-58694694 AGCTTGTTGCGGGGGCAGGAGGG + Intronic
1176686331 21:9851408-9851430 AGCTTATTTGAGAAGCAGGAGGG - Intergenic
1179553707 21:42159606-42159628 TTCTTTCTGCAGATGCACGAGGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1183448921 22:37879781-37879803 AGCTTTGTGCAGTGGCAGTATGG - Intronic
1183917995 22:41138607-41138629 AGTTTTTGTCAGATGAAGGAGGG + Intronic
949780531 3:7681913-7681935 AGCTTTTTGCCTCTTCAGGAAGG - Intronic
952109965 3:30111063-30111085 ATGTTTTTGCAGTAGCAGGAGGG + Intergenic
953038202 3:39231618-39231640 GGCTTGTTACAGCTGCAGGAAGG + Intergenic
954285635 3:49616990-49617012 AGCTGTTTGCCAAGGCAGGAAGG - Intronic
956084586 3:65596706-65596728 GGATTTTTGAAGATTCAGGAAGG - Intronic
958142520 3:89580222-89580244 AGCATTTTGCAGATGCCTGCAGG + Intergenic
958952115 3:100427973-100427995 ATCTTTTTGCAGCTCAAGGAAGG + Intronic
960269681 3:115660039-115660061 AGCTTTTTGCTGAATCATGAAGG + Intronic
962084741 3:132178896-132178918 AGCTTCTTGCTGATCCTGGATGG - Intronic
963286346 3:143438048-143438070 AGCATAATGCAGATGCAGAAAGG + Intronic
964483484 3:157164039-157164061 AGCTTATTGCAGAGGCATGGTGG - Intergenic
964723565 3:159791540-159791562 AGCTTTCTGCAGCTGCTGGAGGG + Intronic
965485128 3:169269333-169269355 AGCTGTATACAGATACAGGATGG - Intronic
966646137 3:182247991-182248013 AGCTCTTGGGAGAGGCAGGAGGG + Intergenic
968317397 3:197736493-197736515 AGCATTTCGCAGAGGAAGGACGG - Intronic
969884240 4:10201075-10201097 GGCTTTTTGCAGAGCCAAGATGG + Intergenic
972385951 4:38565630-38565652 AGCTTCCTGTACATGCAGGATGG + Intergenic
973201931 4:47513576-47513598 AGCATATTTCAGATGGAGGAAGG + Intronic
974986838 4:69037917-69037939 AGCTTTTTGCATATGATGGTTGG + Intronic
975085670 4:70335690-70335712 AGCTTTCTTCAGGAGCAGGAGGG - Exonic
975607021 4:76165129-76165151 ATCTTTTTGAAAATGCAGAAGGG - Intronic
976844599 4:89473686-89473708 AGCTTATTGCAGAAGCAGAGGGG - Intergenic
979107865 4:116710474-116710496 AGCCTTTTGCAGATGTAATAGGG + Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
979689223 4:123542982-123543004 AGCATTTTGCTGAGGCAGGCCGG - Intergenic
982820376 4:159937447-159937469 AGCTTTTTAAAGATGAAGGCTGG - Intergenic
983008010 4:162509309-162509331 ATCTTATTACAGATGCAGGTAGG + Intergenic
983128883 4:163989204-163989226 AGATTATTGTAGATGCATGAAGG - Intronic
983182140 4:164660655-164660677 AGCTTAGATCAGATGCAGGAGGG - Intergenic
983643953 4:169970884-169970906 TGGTTTCTGGAGATGCAGGAAGG - Intergenic
984206419 4:176792639-176792661 AGCTTTTTGGAGAGGCGGGGCGG + Exonic
985820596 5:2157530-2157552 ATCTGGTTACAGATGCAGGAAGG + Intergenic
986126105 5:4883620-4883642 AGCCTTCTGCGGATGCTGGAGGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
989505246 5:42218997-42219019 AGGTTTTGGCAGATACAGGATGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
993425535 5:87759692-87759714 AGCTTGCTGGAGATGCAGCATGG - Intergenic
994326223 5:98448625-98448647 AGCTTTGGGCAGATGCAGGTGGG - Intergenic
994601196 5:101907590-101907612 TGCTTTGTGCAGATGCAGTCAGG + Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
997623546 5:135316361-135316383 AGACTTTTGCAGTTGCAGAATGG + Intronic
998186776 5:139986122-139986144 AGCATTTTGGAGATGCAAGAAGG - Intronic
999649991 5:153756013-153756035 AACTTTCTGCAGAGGCACGAAGG - Intronic
999725108 5:154430573-154430595 AGCTGTGTGCAGCTGCAGCAGGG - Intergenic
1002941825 6:1723742-1723764 AGCCTTTGGCATGTGCAGGATGG + Intronic
1005650179 6:27878778-27878800 GGCTTCATGCAGATGCAGCAGGG + Intergenic
1007098545 6:39229176-39229198 AGCTGTTTTCAGAGGCTGGAGGG - Exonic
1007809735 6:44477236-44477258 AGCTTCTGACAGATGCTGGATGG + Intergenic
1007893382 6:45318501-45318523 AGCTGTTGGCAGTGGCAGGAAGG + Intronic
1007896482 6:45366554-45366576 AGTTTTTAGCAGATAAAGGAGGG - Intronic
1008538955 6:52529662-52529684 TGGATTTTGCAGATGCAAGATGG + Intronic
1013595475 6:111656568-111656590 AGCTTCTGGCAGATGCTGGCTGG - Intergenic
1013748081 6:113368939-113368961 AACTGTTTGAGGATGCAGGAGGG - Intergenic
1014080122 6:117276194-117276216 TGCTTTTTCCAGATGCAGAAGGG - Intergenic
1015735512 6:136395325-136395347 AGCTTTTTGCAGATGCCTGTTGG + Intronic
1016463228 6:144300521-144300543 ACCTCTTTGAAGATACAGGAAGG + Intronic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1018109557 6:160521989-160522011 AGCTGAGTGCAGATGCAGAAGGG - Intergenic
1018237074 6:161736990-161737012 AGCGTTCTGCTCATGCAGGAAGG + Intronic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1022470391 7:30678510-30678532 AGTTATTTCCAGATGCAGCAGGG - Intronic
1022746590 7:33179145-33179167 TGCTTTTTGGAGATTCAGTAGGG - Intronic
1023098232 7:36685362-36685384 AGCTTTTTGCAGGGGGAGGATGG + Intronic
1023106464 7:36767829-36767851 AGCTTTCTTCACATGCAGAAAGG - Intergenic
1023465991 7:40455777-40455799 AGATCTTTGCATATGCAGGAAGG - Intronic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1030461210 7:109839228-109839250 GGCTTCATGCAGATGCAGCAGGG - Intergenic
1030545059 7:110882719-110882741 AGATTCTTGGAGTTGCAGGAAGG - Intronic
1031316995 7:120271247-120271269 AGCTTGTTGAAGATGCAGGAGGG + Intergenic
1032890025 7:136184077-136184099 AGAGTTTTGAAGATGGAGGAAGG + Intergenic
1033403761 7:141052249-141052271 AGCTTTGTGCAGTGGCAGTAAGG + Intergenic
1034971393 7:155421898-155421920 AGCCCTTTGTAGATGCATGATGG - Intergenic
1035359216 7:158299263-158299285 ACCTTTCTGCAGATGCACGCAGG + Intronic
1036384113 8:8263002-8263024 AGCAATTTGTAGATGCAGGTTGG + Intergenic
1037145134 8:15562664-15562686 AGCTTTTGGTAGTTGTAGGAAGG + Intronic
1037220856 8:16518596-16518618 AGTTACTTGCTGATGCAGGAAGG + Intronic
1037288871 8:17329931-17329953 AGATGTTTTCAGATGTAGGAAGG + Intronic
1037893052 8:22634102-22634124 AGCTGTCTGCAGAAGCAGGAAGG + Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044638995 8:94358817-94358839 AGCTGTTTTCAGATGTAGGAGGG - Intergenic
1046891362 8:119424887-119424909 AGCTTCTTGCTGATGCAGTGTGG + Intergenic
1046924200 8:119768726-119768748 ATCTTTTGGCACATGCAGGTGGG - Intronic
1047870341 8:129075333-129075355 AGCTCTTTGCAGTTGCAGGATGG - Intergenic
1048418499 8:134253082-134253104 AGATGTTGGAAGATGCAGGATGG - Intergenic
1049199355 8:141332393-141332415 AACTTGTGGCAGAAGCAGGATGG + Intergenic
1049678894 8:143906716-143906738 AGAGTTTAGCAGATGCAGGCTGG - Intergenic
1050463751 9:5898843-5898865 CCCTTTGTGCTGATGCAGGAAGG - Intronic
1050731932 9:8718699-8718721 ACGTTTCTGCAGATGTAGGAAGG - Intronic
1050886371 9:10771666-10771688 AGGTTTTAGCAGGTGAAGGAAGG - Intergenic
1051354704 9:16231044-16231066 CGCTTTTTGCACAAGCAGGGAGG - Intronic
1052803951 9:32995981-32996003 ATCTTTTTGCTGATGTAGGGGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053782986 9:41630188-41630210 AGCTTATTTGAGAAGCAGGAGGG + Intergenic
1054170939 9:61840330-61840352 AGCTTATTTGAGAAGCAGGAGGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054666597 9:67740482-67740504 AGCTTATTTGAGAAGCAGGAGGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055166612 9:73203164-73203186 AGCTGATTGCAGCTGCATGAGGG - Intergenic
1055594598 9:77852207-77852229 AGCTTTCTTCCGATGCAAGAAGG - Intronic
1056676862 9:88683279-88683301 ACCTTTTTGTAGATGCAGAGAGG - Intergenic
1059564405 9:115369045-115369067 AGCTTAGTGGAAATGCAGGAAGG + Intronic
1060846338 9:126840456-126840478 AGCTTGATGCAGTTACAGGAAGG + Intergenic
1061032185 9:128091997-128092019 AGCTTTTTGGGGAAACAGGACGG + Intronic
1062644873 9:137542727-137542749 GTCTTTGTGCAGCTGCAGGAAGG - Exonic
1186393269 X:9182306-9182328 TGCATTTTGCAGATGCAACAGGG - Intergenic
1187821071 X:23288689-23288711 AGTTTATTGCAAATGCTGGAAGG - Intergenic
1187942194 X:24392882-24392904 GGCTTTTTCCAGCTGCAGGGGGG - Intergenic
1189191085 X:39106628-39106650 AGTTTCTTGCAGTTGTAGGACGG + Intergenic
1189324261 X:40103462-40103484 AGCTTTTGAGAGATGAAGGAGGG + Intronic
1191919108 X:66235268-66235290 GCCTTTTTGTAGATCCAGGATGG + Intronic
1194101215 X:89706662-89706684 TGCTTTTTGCAGATCCTGTATGG - Intergenic
1196697446 X:118628368-118628390 TGCTTTTCGCAGAGCCAGGATGG - Intronic
1198811210 X:140538142-140538164 AGCTCTCTGCAGATGCAGGATGG + Intergenic
1200454166 Y:3367748-3367770 TGCTTTTTGCAGATCCTGTATGG - Intergenic
1200545736 Y:4516508-4516530 TGCTTTTTGTATATGCAGTAAGG + Intergenic
1200928388 Y:8675040-8675062 AGATTTTTGCAGGTGAAGGTGGG - Intergenic
1201614220 Y:15878640-15878662 ATCTCTTTTCAGATGCATGAAGG - Intergenic
1201616148 Y:15901137-15901159 ATCTCTTTTCAGATGCATGAAGG + Intergenic