ID: 1182442651

View in Genome Browser
Species Human (GRCh38)
Location 22:30373300-30373322
Sequence GTGTATGACTGGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182442640_1182442651 27 Left 1182442640 22:30373250-30373272 CCGAGGAGAAGAAAAACTTAGTT 0: 1
1: 0
2: 0
3: 38
4: 411
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214
1182442644_1182442651 3 Left 1182442644 22:30373274-30373296 CCAGAATTCCTCTCCAAGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 197
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214
1182442639_1182442651 28 Left 1182442639 22:30373249-30373271 CCCGAGGAGAAGAAAAACTTAGT 0: 1
1: 0
2: 3
3: 23
4: 282
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214
1182442646_1182442651 -5 Left 1182442646 22:30373282-30373304 CCTCTCCAAGTGGGGTCTGTGTA 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214
1182442642_1182442651 4 Left 1182442642 22:30373273-30373295 CCCAGAATTCCTCTCCAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214
1182442647_1182442651 -10 Left 1182442647 22:30373287-30373309 CCAAGTGGGGTCTGTGTATGACT 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182442651 Original CRISPR GTGTATGACTGGAAGGAAGT GGG Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
900941845 1:5803942-5803964 GTGTATGAATGGAAGGATGGTGG - Intergenic
901245234 1:7725167-7725189 GTGCATGTCTGGAAGGTAGCGGG + Intronic
903095221 1:20965714-20965736 GAGAATGACTGGAAGAACGTGGG - Intronic
906111768 1:43328589-43328611 GCTTAGGACTAGAAGGAAGTTGG + Intergenic
906793470 1:48678414-48678436 GTGTGTGAGTGGAAGGGACTGGG - Intronic
907244600 1:53100442-53100464 GTGTATGAGTGGACCGAGGTGGG - Intronic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
911225453 1:95300332-95300354 GTGTATGACTGAAAAGAGATTGG + Intergenic
912498530 1:110106728-110106750 GTGGATGACAGGCAGGGAGTGGG + Intergenic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
912655802 1:111485496-111485518 GTGTAGGTCAGGAAGGAAGGAGG - Intronic
913324200 1:117612264-117612286 GTGAATGACTGTCAGTAAGTTGG - Intronic
913676018 1:121141260-121141282 TTATATGACTGGCAGCAAGTGGG + Intergenic
915448877 1:155990793-155990815 GTCTAGGCCTGGAAGGAAGGAGG + Intronic
917652171 1:177088720-177088742 GAGTACGACTGGAAGGCAGAGGG - Intronic
917989204 1:180355794-180355816 TTGTATGACTTGAAGACAGTTGG - Intronic
918569520 1:185972345-185972367 GTGTATCACTGGATGGAAGAAGG - Intronic
918599377 1:186336966-186336988 GTGTATAACAGGAAAGAATTAGG + Intronic
919340199 1:196296448-196296470 ATATATTACTGGAAGGAATTTGG + Intronic
920463388 1:206160098-206160120 TTATATGACTGGCAGCAAGTGGG + Intergenic
921309310 1:213827101-213827123 ATGTGTGACTGGATGGATGTGGG + Intergenic
924866837 1:247991984-247992006 GTGAGTGACTGATAGGAAGTTGG + Intronic
924946667 1:248851134-248851156 ATGTATGAATTGAAGGCAGTGGG + Intronic
1062854213 10:771572-771594 GTCTTTGACTTGAAGGAACTGGG - Intergenic
1063838370 10:10042448-10042470 TTGTCTGAGTGGAAGGAAGCTGG - Intergenic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1065264186 10:23957769-23957791 GTGTATGCCTGGATGGGAGGAGG - Intronic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067541896 10:47160826-47160848 TTGTCTGACTGGAGGGAGGTAGG - Intergenic
1068789740 10:61014615-61014637 GTGTATGTCTGAAAGGAATTTGG + Intergenic
1069136173 10:64768919-64768941 GTGTATGACAGGAAGGTGATGGG - Intergenic
1070331284 10:75419093-75419115 GTGAAGGACTGAAAGGAAGATGG - Intergenic
1070658625 10:78289018-78289040 GTGGATGTCTGGAAGAAAATAGG + Intergenic
1074417698 10:113281803-113281825 GGGAATGGCTGGAAGGAAGGAGG + Intergenic
1074522258 10:114236612-114236634 ATATATGACTGGAAGGGAGACGG - Intergenic
1074816342 10:117143650-117143672 TTCTGTGACTGGAAGCAAGTAGG - Intergenic
1076420946 10:130331141-130331163 GACTATGACTGGAAGTGAGTGGG - Intergenic
1078670959 11:13364633-13364655 TTGTATGTCTGGAAGGCAGTGGG + Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1080361722 11:31521942-31521964 GTAAATGACTGGTAAGAAGTTGG - Intronic
1082808895 11:57466756-57466778 GAGAATGACTGGAAGTAACTTGG - Intronic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1086564414 11:88209235-88209257 TTGTACGAATGGATGGAAGTGGG + Intergenic
1087265220 11:96053426-96053448 CTGGATGATTGGAAGAAAGTCGG - Intronic
1087658025 11:100949740-100949762 GTGAACCACAGGAAGGAAGTTGG + Intronic
1087694791 11:101364386-101364408 GTTTATGATAGGGAGGAAGTAGG - Intergenic
1087994775 11:104791964-104791986 GTGTATGAGGGAAAGGAATTAGG - Intergenic
1088378546 11:109168426-109168448 GGCTATGATTAGAAGGAAGTGGG + Intergenic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1089997520 11:122922882-122922904 GTGTATGACTAGAAAGAACTTGG - Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1093688636 12:22084657-22084679 GTGTATGTCTGGAGGCAGGTGGG - Intronic
1096360476 12:50981521-50981543 GTGTATGACTGTTATGAGGTGGG + Intronic
1099613879 12:84911713-84911735 GTGTGTGACTGGGAAGAAGACGG - Intronic
1103175038 12:118855602-118855624 GGGTATGACTGGAAGGGAAAGGG + Intergenic
1104137202 12:125951923-125951945 GTGTGTGTCTGGTAGGAAATGGG - Intergenic
1104578228 12:129988137-129988159 GTGGATGACTGGTAGAGAGTGGG + Intergenic
1108481716 13:50879188-50879210 GTGTATGACAGGAAAACAGTGGG + Intergenic
1109031970 13:57202485-57202507 GCATATGAATGCAAGGAAGTGGG - Intergenic
1109748728 13:66662067-66662089 GTGTATGTGTGTTAGGAAGTGGG + Intronic
1112219654 13:97474932-97474954 GTGTATATTTGGAAAGAAGTCGG - Intergenic
1113314939 13:109168865-109168887 GTGTATGAGTGGAAGGGGCTCGG + Intronic
1115770584 14:36661563-36661585 GTGAATGACTCGAAGGGAGAAGG - Intronic
1117294060 14:54362787-54362809 GTGTATGACCAGGAGGAAGCAGG + Intergenic
1120576297 14:86185703-86185725 TTGTATGAGTGGGAGTAAGTAGG + Intergenic
1121066312 14:90969686-90969708 GAGTATTACTGGAAATAAGTAGG - Intronic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122580577 14:102769155-102769177 GGCTCTGACTGGAAGGAAGAGGG + Intergenic
1124496376 15:30190072-30190094 GTGTCTGAGTAGCAGGAAGTGGG - Intergenic
1124747199 15:32348576-32348598 GTGTCTGAGTAGCAGGAAGTGGG + Intergenic
1126498694 15:49320904-49320926 GTCTTTGCCTGGAAGGAAGTGGG + Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1127752778 15:62062135-62062157 GTGTATGACTAGAAAGAACGTGG - Intergenic
1129154355 15:73708698-73708720 GAGTGTGACTGGAAGGTGGTGGG + Intronic
1130071233 15:80647966-80647988 GTGTCTGTGTGGAAAGAAGTAGG + Intergenic
1130311094 15:82755054-82755076 ATGAATGTTTGGAAGGAAGTAGG + Intergenic
1132798036 16:1734880-1734902 GTGTGTGTCTGGAATGCAGTCGG + Intronic
1133577661 16:7109458-7109480 GTGGATGTATGGAAGGAAGGTGG + Intronic
1134303162 16:13009319-13009341 TTGAATGACTGGAAGGGATTGGG + Intronic
1135257119 16:20949855-20949877 GTTTATGACCGGCAGGCAGTTGG + Intronic
1135327956 16:21539387-21539409 GTCTCTGTCTGGAAGGAAGATGG + Intergenic
1141360718 16:83392925-83392947 GTGAAGAGCTGGAAGGAAGTTGG + Intronic
1142643285 17:1297038-1297060 GTGTATGAAAGGAAGAAAATCGG - Intronic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1150879601 17:69008995-69009017 GAGTACATCTGGAAGGAAGTAGG + Intronic
1154303557 18:13215276-13215298 GTGTGTGTCTGGAAGGGTGTGGG + Intergenic
1155408316 18:25513965-25513987 GAGTAAGACTGGAAGGATCTTGG - Intergenic
1155775794 18:29758709-29758731 GTGTATGCAAGGAAGTAAGTTGG - Intergenic
1156041854 18:32831888-32831910 GTGTATGAGTCGAAAGGAGTTGG + Intergenic
1156519287 18:37708066-37708088 AAGTATGACTGGAAGGGAGAAGG - Intergenic
1156561264 18:38128378-38128400 GTGCATGAGTGGAAGGAAACTGG + Intergenic
1156570227 18:38244183-38244205 GTGTGTGCATGGCAGGAAGTAGG - Intergenic
1157147323 18:45177174-45177196 GAGTAGGAATGGCAGGAAGTGGG - Intergenic
1157745941 18:50135654-50135676 GTGTATTACTTAAATGAAGTGGG + Intronic
1160488128 18:79312046-79312068 GGGAATGACTGGAGGGAAGGCGG - Intronic
1162440972 19:10691866-10691888 GTGGTTGACTGGGATGAAGTTGG + Exonic
925182536 2:1826578-1826600 GTGTTTGACGGGAAGCAATTGGG - Intronic
926169794 2:10545609-10545631 GTGCAGGACTGGAAGGTAGGCGG - Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
929961752 2:46502491-46502513 GTGTATGGTTGGGGGGAAGTGGG - Intronic
930671440 2:54155648-54155670 GTGGAAGACAGGAAGGAAGCAGG - Intronic
931496871 2:62817309-62817331 GTAAAAGACTTGAAGGAAGTGGG + Intronic
934532670 2:95104797-95104819 GTGTATGCCTGCAAGGAAGGCGG - Intronic
938127871 2:128687387-128687409 GTGTGTGAGTGGTATGAAGTGGG + Intergenic
938421653 2:131151761-131151783 GTGAATGGCTGGAGGGAAGGGGG + Intronic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
940249180 2:151655364-151655386 GTGTATAAATGCTAGGAAGTGGG + Exonic
941267142 2:163376498-163376520 GTATATTTCTGGTAGGAAGTTGG + Intergenic
941441158 2:165538493-165538515 GTGAGAGACTGGATGGAAGTGGG - Intronic
944404011 2:199361519-199361541 GTGTATGGCAGGAAGGGAGGTGG - Intronic
945303525 2:208236586-208236608 GCACATGACTGGAACGAAGTAGG - Exonic
945895365 2:215475090-215475112 GTGTATGGATGGGAGGAAGGCGG + Intergenic
946662340 2:222015016-222015038 GTGTCTGAAGGGAAGGAAGTGGG - Intergenic
1170434931 20:16316583-16316605 CTGAATGACTGGAATGAAGAAGG + Intronic
1170917146 20:20638305-20638327 GGGCATGTCAGGAAGGAAGTTGG - Intronic
1172575391 20:36004188-36004210 GTGTGTGACTAGTAGGAGGTGGG + Intronic
1173794050 20:45846528-45846550 GAGTATGACGGGATGGATGTGGG - Intronic
1174185633 20:48703968-48703990 GTGCATGTCTGGAAGGAAGGAGG - Intronic
1177854836 21:26388896-26388918 GTGTATAACAGGAAGAAAGAAGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178767217 21:35465833-35465855 GTTTATGTCAGGAAGGAATTTGG - Intronic
1178781481 21:35607000-35607022 GTGCATGAGTGGAAGGCAGTAGG + Intronic
1178823270 21:35994151-35994173 GTGTGTGACTTGAAGTGAGTTGG - Intronic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1183662651 22:39230572-39230594 ATGGTTGTCTGGAAGGAAGTGGG + Intronic
1184864835 22:47196305-47196327 GTGTCTGGGTGGAAGGAAGGAGG + Intergenic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
951670059 3:25171182-25171204 GTGGAAGACAGGAAGGAAGTAGG - Intergenic
951825190 3:26860441-26860463 GTGTATGGCAGGAGGGAAGGGGG - Intergenic
952408981 3:33030542-33030564 GTTTATGACTGGAATGACATTGG - Intronic
952839171 3:37629871-37629893 GTGTATCACTCGTATGAAGTAGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954005361 3:47586325-47586347 GGGAAAGACTGGCAGGAAGTAGG + Exonic
955279036 3:57576325-57576347 GTGTACGAGAGGAAGGAAATGGG + Intronic
955959264 3:64322230-64322252 GAGTGTGAATGGAAGGAGGTAGG + Intronic
956077520 3:65521369-65521391 ATATATCACTGGAAGGATGTTGG + Intronic
956827493 3:73011986-73012008 GTGTATATCTGGGAGGAAGGGGG + Intronic
957277193 3:78105835-78105857 CTGCATGAGTGGAAGAAAGTAGG + Intergenic
960417324 3:117400324-117400346 GTGTAAAACTGAAATGAAGTTGG + Intergenic
961315207 3:126030021-126030043 GTGTGTGAATGGTATGAAGTAGG - Intronic
962507753 3:136065339-136065361 GTAAATGATTGGAAAGAAGTGGG + Intronic
962996821 3:140636980-140637002 GAGTATGACTAAAAGGAAGTAGG - Intergenic
963324403 3:143845933-143845955 GTTTATGAGTGGAATTAAGTTGG - Intronic
967578275 3:191123071-191123093 GAGTATCATTGCAAGGAAGTAGG - Intergenic
970600096 4:17635163-17635185 GGGTTTGACTTGAAGGAAGATGG + Intronic
971205934 4:24568600-24568622 GTGTATGTGTAGTAGGAAGTGGG - Intronic
971582255 4:28356887-28356909 ATGAAAGCCTGGAAGGAAGTAGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972012590 4:34203538-34203560 GTGTATGAGTTGGTGGAAGTGGG + Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
976302749 4:83530679-83530701 GGGAATGACGTGAAGGAAGTGGG + Intergenic
978468324 4:109032946-109032968 TTGTATAAATGAAAGGAAGTAGG + Intronic
978964976 4:114729530-114729552 GCGTATGGCTGGCAGGAAGATGG + Intergenic
984270647 4:177545046-177545068 TTAAATGACTGGAAGAAAGTAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
987680537 5:21130605-21130627 ATGCATGACAGGAAGGGAGTTGG - Intergenic
988646843 5:33104519-33104541 GTGTGTGACTGTGAAGAAGTTGG + Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999970217 5:156851992-156852014 GTGTATGTGTGGAAAGGAGTAGG - Intergenic
1000233718 5:159338315-159338337 GTGGGCAACTGGAAGGAAGTGGG + Intergenic
1000390948 5:160722774-160722796 GTGCATGGCTGGAGGGAAGCAGG - Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001646408 5:173285079-173285101 GTGGATGACTGGATGGATGAGGG - Intergenic
1001900161 5:175420521-175420543 GTGGATGAATGGAAGGATGGAGG - Intergenic
1003601102 6:7518195-7518217 CTGAAAGACTGGAAGGAATTGGG - Intergenic
1004060371 6:12190663-12190685 GAGTATGAAAGGAAGGAATTAGG - Intergenic
1004813093 6:19281367-19281389 GTCTGTGTCTGGAAGAAAGTTGG + Intergenic
1005150230 6:22740594-22740616 GTGTAAGAATGGGAAGAAGTTGG + Intergenic
1005730627 6:28693646-28693668 TTGTATGTTTGAAAGGAAGTAGG - Intergenic
1006922912 6:37638182-37638204 GTGCAAGACGGGAAGGAGGTGGG - Intronic
1007322806 6:41039418-41039440 GTCTAGGTCTGGAAGGAAGGAGG + Intronic
1007533306 6:42562429-42562451 GTGGATCAGTGTAAGGAAGTTGG + Intergenic
1007907595 6:45477927-45477949 GTGTGTGGGTGGAAGGCAGTTGG - Intronic
1007994240 6:46289169-46289191 ATGTAGGAGAGGAAGGAAGTTGG - Intronic
1009334391 6:62468611-62468633 TTTTTTTACTGGAAGGAAGTAGG + Intergenic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1013825791 6:114209736-114209758 GTGAATGACTGGAAGTCAGAAGG + Intronic
1013942192 6:115678398-115678420 GTGTATATGTGGAAGGGAGTTGG + Intergenic
1016317657 6:142808313-142808335 GTGAATGGATGGAAGGAAGGAGG + Intronic
1018852997 6:167654633-167654655 GTGAATGACTAGGAGGAGGTAGG - Intergenic
1019159441 6:170059167-170059189 GTGTGTCGCTGGAAGGCAGTGGG + Intergenic
1019233822 6:170591818-170591840 GTGTATGATTTGAATTAAGTTGG + Intergenic
1019422148 7:955434-955456 GTGGTTGCCTGGAAGGCAGTGGG - Intronic
1021586512 7:22214560-22214582 GTATATGACTAGATGGATGTGGG - Intronic
1022879679 7:34573491-34573513 GTAGAGGACTGGAAGGAAGAGGG - Intergenic
1023785922 7:43707504-43707526 GTTAATGATTGGAAAGAAGTGGG - Intronic
1024168126 7:46755279-46755301 GCGCAAGACAGGAAGGAAGTGGG + Intronic
1028370170 7:90082917-90082939 GTGGATTCCTTGAAGGAAGTAGG + Intergenic
1028386116 7:90254983-90255005 GTGGATGACTGGAAGAATGCTGG + Intronic
1028844891 7:95468715-95468737 GTGTATGACTAGACGTAAGTGGG + Intergenic
1029158173 7:98532097-98532119 GTGAAGGACTGGAAGGTATTTGG - Intergenic
1031798885 7:126216162-126216184 GTGCATGCATGTAAGGAAGTGGG - Intergenic
1032444819 7:131973161-131973183 ATGTATCACTGGAAGGAAGCTGG + Intergenic
1033591157 7:142809403-142809425 TTACATGAGTGGAAGGAAGTGGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035954761 8:4064565-4064587 TTGTATGACAGGGTGGAAGTAGG - Intronic
1036066362 8:5385395-5385417 GTGTAGTAGAGGAAGGAAGTAGG - Intergenic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1041234792 8:55789230-55789252 TTGTCAGACTGGAAGAAAGTGGG - Intronic
1042953209 8:74221936-74221958 GTGTGTGACAGCAAAGAAGTTGG + Intergenic
1045649855 8:104331511-104331533 GTGTAAGACAAGAAGGGAGTCGG - Intronic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1048788121 8:138073578-138073600 TTGAATGACTGGATGGAAGGCGG + Intergenic
1049630328 8:143651076-143651098 GTGTATGAATGTAAGGAATGTGG + Exonic
1050696050 9:8280629-8280651 GTGCAGGATTGGAAGCAAGTGGG - Intergenic
1052384501 9:27807761-27807783 TTGTTTGACTGGATGGAAGAGGG + Intergenic
1053361852 9:37493693-37493715 GGGTGTGACTGGTAAGAAGTTGG + Exonic
1054454363 9:65421971-65421993 GTGGATGAGTGGATGGAAGATGG + Intergenic
1056856219 9:90131897-90131919 GTCTGTGACTGGAGGGATGTGGG - Intergenic
1057280624 9:93708655-93708677 GTTTCTGACTGGAAGGAACATGG - Intergenic
1057901471 9:98952104-98952126 GTGCAGGACTGGCATGAAGTGGG + Intronic
1058955309 9:109941430-109941452 GTGTTTGGCTGTAAGAAAGTAGG + Intronic
1059422757 9:114202654-114202676 CTGTATGACTGGAATAGAGTGGG - Intronic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1060005021 9:119992196-119992218 GTGTCTGACTGGGAGGGAGGAGG - Intergenic
1060382732 9:123191924-123191946 GTATAAGAGTGGAAGGAAGGAGG + Intronic
1062693289 9:137856793-137856815 GGGTATGATGGGATGGAAGTGGG + Intronic
1188253741 X:27933149-27933171 GTGTATTACAGGAAGTAACTAGG - Intergenic
1191749151 X:64522490-64522512 GTAAATGAATGGAAGGAGGTGGG - Intergenic
1192216699 X:69164440-69164462 GTATATGACAGGAAGGAAGAAGG + Intronic
1194652315 X:96530681-96530703 GCCTATGGCTGGAAGGAAATGGG + Intergenic
1196552316 X:117043473-117043495 GTTTTTAACTAGAAGGAAGTTGG + Intergenic
1198206442 X:134469698-134469720 GTGAGTAACTGGGAGGAAGTTGG + Intronic
1199323017 X:146463332-146463354 GTGTTTGACTGGAGTGGAGTGGG - Intergenic
1200946917 Y:8851700-8851722 GGGTATGTATGGAATGAAGTAGG + Intergenic
1201670949 Y:16519374-16519396 GTGAATGATTGGAAGGCAGGAGG - Intergenic
1202024719 Y:20509017-20509039 TTGTATCACTGGAAGGAGGTAGG - Intergenic