ID: 1182444766

View in Genome Browser
Species Human (GRCh38)
Location 22:30383587-30383609
Sequence TCTGCTGGGCAGTCACGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182444766_1182444771 2 Left 1182444766 22:30383587-30383609 CCGGGACGTGACTGCCCAGCAGA 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1182444771 22:30383612-30383634 AGGGACTCAAGAAATGCTTGTGG 0: 1
1: 1
2: 5
3: 67
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182444766 Original CRISPR TCTGCTGGGCAGTCACGTCC CGG (reversed) Intronic
900100877 1:961470-961492 TCTCCTTGGCAGCCACGTGCAGG - Exonic
900115661 1:1026769-1026791 TCTGAGGGGCAGGCACCTCCTGG - Intronic
901012447 1:6209410-6209432 TCTGCAGGGCCTTCACGGCCTGG - Exonic
901071309 1:6520155-6520177 TCAGCTGGGCAGACATGTGCTGG - Intergenic
903666897 1:25013583-25013605 TGTGATGGGCAGACAGGTCCTGG - Intergenic
904031491 1:27536215-27536237 TCTGCTGGGCAGTCAGCCCCGGG + Intronic
907486125 1:54779454-54779476 CCTGCTGTGGAGTCACCTCCTGG + Intergenic
912748298 1:112264442-112264464 TCTCCTTGGCAGCCACCTCCAGG + Intergenic
914934692 1:151968289-151968311 TCTGCTGGGCATCCACTCCCAGG - Intergenic
915918689 1:159958064-159958086 TGTGGTGGGCAGGCATGTCCAGG + Intergenic
916446488 1:164876931-164876953 TCTGCGGGGCTGTGAGGTCCAGG - Intronic
920065489 1:203266691-203266713 TCTGCCGGGCCGCCACGTCTGGG - Intronic
923083376 1:230681784-230681806 TCTGCTGTGCAGTCACTTCCAGG - Intronic
1065806359 10:29396893-29396915 GCTGCTGGGCAGGCTGGTCCTGG + Intergenic
1065958121 10:30710900-30710922 ACTGCTAAGCAGTCACGTGCAGG + Intergenic
1067749393 10:48960121-48960143 TATGCTGAGCAGTCAGGCCCAGG - Intronic
1069015775 10:63427419-63427441 TCTGGTCAGCAGTCACCTCCCGG - Intronic
1069618628 10:69822417-69822439 CCTGGTGGGCAGTTACATCCTGG - Exonic
1080315215 11:30939465-30939487 TCTGGTGAGCAGGCACATCCAGG + Intronic
1083774876 11:64889511-64889533 TCTGCTGGGCACGCACATCCAGG - Intergenic
1086930217 11:92684389-92684411 TCTGCTGGGCACTCATGTCCAGG - Intronic
1087083622 11:94195593-94195615 TCTGCTGGGCAGTCCAGACTGGG - Intergenic
1088348782 11:108861256-108861278 TCTGGTAGGCAGGCACGTCCAGG - Intronic
1090719505 11:129458906-129458928 TCTGCAGGTCAGCCACGGCCAGG + Intergenic
1092155599 12:6279717-6279739 TCTGCTGGGCACTCACATTCAGG - Intergenic
1096454058 12:51770662-51770684 TCTGCTGAGCAGTGGCGCCCTGG + Exonic
1096599762 12:52721251-52721273 TCTGGTTGACAGTCACTTCCTGG + Intergenic
1098331749 12:69360274-69360296 TTTCCTTGGCAGCCACGTCCGGG - Intronic
1098856071 12:75654604-75654626 TCTGCTGGGCTGTCAGGTTTTGG - Intergenic
1100493073 12:95099671-95099693 TCTGCTGGGCACTCACTACCTGG + Intronic
1101897172 12:108765580-108765602 TCTGCTGGGCCCACACCTCCAGG + Intergenic
1102865957 12:116374102-116374124 ACTGCTGGGCAGTCTGGACCTGG - Intergenic
1104368848 12:128204311-128204333 TCACCTGGGCAGTCTCTTCCTGG + Intergenic
1104796840 12:131526106-131526128 TCTGCTGGTCAGCAAGGTCCTGG - Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1105307400 13:19178791-19178813 TCTGCAGGGCAGTCCCATCAGGG + Intronic
1105327856 13:19386506-19386528 ACAGCTGGGCAGTCCAGTCCCGG - Intergenic
1105797829 13:23873859-23873881 GCTGCTGGGAAGGCACGTCCTGG + Intronic
1110262029 13:73496070-73496092 TCTGCTGGGCAGTCACTGCTGGG - Intergenic
1111241545 13:85481687-85481709 TCTGGTGGGCAGGCACACCCGGG + Intergenic
1117519015 14:56531613-56531635 TCTGATGGGCAGGCACACCCAGG - Intronic
1118142150 14:63095809-63095831 TCTGCTGGGCTGTGTTGTCCTGG - Intronic
1118459121 14:65972358-65972380 TGTGCAGGGCAGTCATATCCAGG - Intronic
1119190687 14:72679926-72679948 TCTGCAGGGAAGGCACGTCGGGG - Intronic
1121476938 14:94217390-94217412 TCTGCTAGGCTGTTAAGTCCAGG - Intronic
1121786940 14:96669005-96669027 GCTGCTGGGGAATCAAGTCCAGG + Intergenic
1122350449 14:101086960-101086982 GCTGCAGGGCAGACACGTACTGG + Intergenic
1123700534 15:22911604-22911626 TCTGCTGGGCAGATGGGTCCTGG - Intronic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124635546 15:31362402-31362424 TGTGCTGGGCAGTGGCTTCCAGG - Intronic
1129617181 15:77107839-77107861 TCTGGTGAGCAGTCACCTGCAGG - Exonic
1131633383 15:94203609-94203631 TCTGATAGGCAGGCACATCCTGG - Intergenic
1132508159 16:322903-322925 TCTGGTCTGCAGTCATGTCCAGG + Intronic
1134194381 16:12147822-12147844 CCTGCAGGGCATTCACATCCTGG - Intronic
1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG + Intronic
1136349584 16:29698142-29698164 TCTGCTGTGCACTCACAGCCAGG - Exonic
1139195537 16:64914536-64914558 TATGCAGGGCAGTCACGTTGGGG + Intergenic
1139667992 16:68471712-68471734 TCTACTGGGCAGGCACGAGCTGG - Intergenic
1139745895 16:69074054-69074076 CCTGCTGGGCAGTTACCTCCTGG - Intronic
1139956159 16:70693984-70694006 TCTGCTGGGCAGCCAGGCCTAGG - Intronic
1142011031 16:87714293-87714315 TCTGCTGGGCAATCACCTTTGGG - Intronic
1143465566 17:7134067-7134089 TCTGCTGGTCAGTGACCTGCCGG + Intergenic
1144851154 17:18244675-18244697 TCTGCTGGGCACCCACATCTGGG + Exonic
1146451042 17:32974208-32974230 TCTGGTAGGCAGGCACGCCCAGG - Intronic
1146520487 17:33521986-33522008 TCTGCTGGGCAGCCGCTGCCTGG + Intronic
1146727816 17:35170213-35170235 CCTGCAGGGCAGGGACGTCCTGG - Exonic
1147142627 17:38467944-38467966 TCTGCTGGGCCATCCAGTCCAGG - Intronic
1150484145 17:65532526-65532548 CCTGCTGGCCAGTTACCTCCAGG + Intronic
1152057487 17:78041364-78041386 TCTGCTGGGCTGGCACGGGCAGG + Intronic
1152210882 17:79002540-79002562 CCTGCTGTGTAGTCACGTCCTGG + Intronic
1152737954 17:82006695-82006717 CCTGCAGGGCAGTCAAGGCCTGG - Intronic
1153978241 18:10287978-10288000 CCTGCTGGGCAGTCAGAGCCAGG - Intergenic
1155247841 18:23927100-23927122 CCTGCTGAGCATTCACGTCCAGG + Intronic
1160689369 19:454261-454283 TCTGCTGGGCAGTGCCGGGCTGG + Intronic
1161169594 19:2806210-2806232 TCAACTGGGCAATCCCGTCCTGG + Intronic
1161483694 19:4523671-4523693 TCTGCTGGGCCGGCCAGTCCAGG + Exonic
1163112588 19:15170464-15170486 GCTGCTGGTCATTCTCGTCCTGG - Exonic
1163294683 19:16404650-16404672 TCTGCTGGTCCATCTCGTCCAGG + Exonic
1167244672 19:48365764-48365786 CCTGCTGGGCACTGCCGTCCGGG - Exonic
1167763280 19:51462550-51462572 TCGGCTGTGCAGTCACCACCAGG - Intergenic
1168666721 19:58210001-58210023 CCTGCTGGGCAGTGACCTCGAGG - Exonic
925405733 2:3604493-3604515 GCTGCTGGGCAGTGGCCTCCGGG + Intronic
927554688 2:24023455-24023477 TCTGGTGGCCAGTCTGGTCCTGG + Intronic
927863892 2:26576713-26576735 CCTGCAGGGCAGTCTCGCCCAGG - Intronic
928357072 2:30627180-30627202 TCTGGTGGGCAGGCACACCCAGG + Intronic
930397688 2:50844147-50844169 TCTGGTGAGCAGGCACATCCAGG + Intronic
931036003 2:58243488-58243510 TCTGGTGAGGAGTCACTTCCTGG + Intergenic
933194439 2:79372294-79372316 TTTGCTGGGCAGTGACATCAAGG - Intronic
938298761 2:130195596-130195618 TCTGCAGGGCAGTCCCATCAGGG + Intronic
938457960 2:131478917-131478939 TCTGCAGGGCAGTCCCATCAGGG - Intronic
944658312 2:201898851-201898873 TCTCTTGGGCAGTCACATCCTGG - Intergenic
946301071 2:218824350-218824372 TTTGCTGGGCAGCCAGGTGCTGG + Exonic
948908128 2:240989506-240989528 TCTGCTGGGCAGTCCTGGCCAGG + Intronic
1169720202 20:8667873-8667895 TCTGCTGGGAGGTCACATCTAGG - Intronic
1171294761 20:24007874-24007896 TATGCTGTGCAGTCAGGACCTGG + Intergenic
1174919085 20:54682838-54682860 TCTGCTGGGCAGTCACAGGGCGG + Intergenic
1175958413 20:62622994-62623016 CCTCCTGGGCGGTCACCTCCCGG + Intergenic
1180831925 22:18910953-18910975 TCTGCTGGTCAGCCACCTTCCGG - Exonic
1181067920 22:20315389-20315411 TCTGCTGGTCAGCCACCTTCCGG + Exonic
1181390790 22:22579441-22579463 TCTGCTTGGCACCCACCTCCAGG - Intergenic
1181415845 22:22758342-22758364 TCTGCTTGGCACCCACCTCCAGG - Intronic
1181420137 22:22792129-22792151 TCTGCTTGGCACCCACCTCCAGG - Intronic
1182444766 22:30383587-30383609 TCTGCTGGGCAGTCACGTCCCGG - Intronic
1183457545 22:37930825-37930847 TCTGCTGGTCAAACACTTCCTGG + Intronic
1183969872 22:41468813-41468835 GCTGCTGGGCGGCCAGGTCCTGG + Intergenic
1184235238 22:43179758-43179780 TCTGATGGGCACTCATGTCTTGG - Intronic
1185087515 22:48748863-48748885 TCTCCTGGGCGGGCACCTCCAGG - Intronic
1203282003 22_KI270734v1_random:136224-136246 TCTGCTGGTCAGCCACCTTCCGG - Intergenic
955192967 3:56778956-56778978 TTTGCTGACCAGTCATGTCCTGG + Intronic
965040852 3:163505149-163505171 TCTGCTGAGGAGTCTCTTCCTGG + Intergenic
968353230 3:198080317-198080339 TGTCCTGGGCATCCACGTCCCGG + Intergenic
968441907 4:628570-628592 TCTGCAGGGCAGGCAGGCCCCGG + Intronic
969915532 4:10487694-10487716 TATGCTGGGCAGTAATGTCTGGG - Exonic
977880491 4:102198897-102198919 TCTGGTGGGGATTCACTTCCTGG + Intergenic
980458647 4:133076549-133076571 TATGCAGGGCAGTGAGGTCCTGG + Intergenic
989149040 5:38280274-38280296 TCTGCCGTGCACTCACGTACTGG + Intronic
996092343 5:119363366-119363388 TTGGCAGGGCAGTCACCTCCTGG - Intronic
997266812 5:132499669-132499691 TCTGGTGGCTAGTCACCTCCAGG + Intergenic
997352972 5:133244156-133244178 TCTCCTGGGGACTCAGGTCCAGG - Intronic
1000641965 5:163713416-163713438 TTTGATGGGCAGTCACTTCACGG - Intergenic
1001647767 5:173295038-173295060 TCTTCTGGGTAGCCAAGTCCAGG + Intergenic
1001886343 5:175293754-175293776 TCTGCTGGGTTGTTAGGTCCTGG - Intergenic
1002176628 5:177404536-177404558 CTTGCTCGGCAGTCACGTTCCGG + Exonic
1005041467 6:21604181-21604203 ACTGCTGGGCATTCACTGCCTGG - Intergenic
1007976193 6:46103861-46103883 TCTGCTGGCTTGTCAGGTCCTGG - Intergenic
1008255365 6:49293307-49293329 TCTGCTGGGGAGTCACTCCAGGG - Intergenic
1016293492 6:142549512-142549534 ACTGCTGGGCTTTCACCTCCAGG - Intergenic
1016597213 6:145815370-145815392 CCTGGTGGGCTGTCCCGTCCGGG - Intergenic
1017387135 6:153899364-153899386 TCTGGTAGGCAGGCACATCCAGG - Intergenic
1018043894 6:159949422-159949444 TCTGCTGGCCTGTCAGGTCCTGG - Intergenic
1018705837 6:166462527-166462549 TCTGCTGCTAAGTCAGGTCCCGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019707911 7:2505140-2505162 TCTGCTGGGCAGGGGCGTCCAGG + Intergenic
1025261657 7:57424508-57424530 TCCGCTGGGCCGTCGTGTCCCGG - Intergenic
1031837756 7:126699111-126699133 TCTGCCTGGCAGTCAGGTGCAGG - Intronic
1033658504 7:143388690-143388712 TGTGCTGGGCAGTCGGGCCCTGG + Intronic
1035221267 7:157407832-157407854 TTTGCTGAGAAGCCACGTCCTGG + Intronic
1038001908 8:23399195-23399217 TCTGCATGGCAGTCACACCCTGG - Intronic
1048107751 8:131429769-131429791 TCTGCTAAGCACTCATGTCCAGG + Intergenic
1048845800 8:138602713-138602735 TCTGGAGGGCAGTCACGTCAGGG + Intronic
1048967546 8:139625364-139625386 CCTGCTGGGTAGTCACAGCCTGG + Intronic
1049052520 8:140210142-140210164 TCTGCTAGGCTGGCACGCCCAGG - Intronic
1049350363 8:142160996-142161018 TCCGCTGGGCAGTCTCTCCCAGG + Intergenic
1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG + Intergenic
1050318317 9:4425739-4425761 CCTGCTGGGCAGTCCCGAGCAGG - Intergenic
1051699677 9:19808574-19808596 TCTGGTAGGCAGACACATCCAGG + Intergenic
1053154963 9:35771207-35771229 TCTGCTTGGCTGGCAAGTCCCGG + Intergenic
1061545668 9:131302703-131302725 TGTGCTGGCCAGGCACTTCCAGG + Intronic
1062339517 9:136087760-136087782 TCAGCTGAGCAGCCACTTCCAGG - Intronic
1203786837 EBV:132972-132994 CGTGCTGGGCAGTCAGGGCCTGG + Intergenic
1187987399 X:24829205-24829227 TCTTCTGGGCAGTCCCTTCTTGG + Intronic
1189206091 X:39240248-39240270 TATGCTTGGCAGTCAATTCCTGG - Intergenic
1189265695 X:39714559-39714581 TTTGCTGTGCAGTCATCTCCTGG + Intergenic