ID: 1182444842

View in Genome Browser
Species Human (GRCh38)
Location 22:30384098-30384120
Sequence CCTCATGTTCTGCAGGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182444842_1182444847 9 Left 1182444842 22:30384098-30384120 CCCAATGCCTGCAGAACATGAGG 0: 1
1: 0
2: 1
3: 12
4: 177
Right 1182444847 22:30384130-30384152 AACACTGACTACATGTGACCTGG 0: 1
1: 0
2: 0
3: 10
4: 103
1182444842_1182444848 15 Left 1182444842 22:30384098-30384120 CCCAATGCCTGCAGAACATGAGG 0: 1
1: 0
2: 1
3: 12
4: 177
Right 1182444848 22:30384136-30384158 GACTACATGTGACCTGGCCCAGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182444842 Original CRISPR CCTCATGTTCTGCAGGCATT GGG (reversed) Intronic
904409008 1:30313633-30313655 CCTCAGGTTCTGGAGACACTCGG + Intergenic
904895947 1:33818380-33818402 GCTCATGTTCTACTGGCATGAGG + Intronic
905408190 1:37751637-37751659 CCTCATGATCTGCTGGCCTCAGG - Intronic
906094402 1:43211339-43211361 CCTCATGATCTGCCCGCCTTGGG - Intronic
910209114 1:84775657-84775679 GCTCATGTGCTGCAGACATCCGG - Intergenic
912639140 1:111327876-111327898 TCTCATCTTCTGCAAGCTTTGGG + Intergenic
919811754 1:201413035-201413057 CCTGGTGTTGTGGAGGCATTTGG + Exonic
921160583 1:212469526-212469548 CCTCATGATCTGCCCGCCTTGGG - Intergenic
921300444 1:213746539-213746561 GCTTATATTCTGCAGGCAATAGG + Intergenic
924455047 1:244212592-244212614 CCTCATGCTCTGCAAGGCTTTGG + Intergenic
1063167617 10:3478407-3478429 CCTCATGTTTCTCATGCATTTGG + Intergenic
1063947448 10:11191665-11191687 CCTCATCTTCTGCAGGGAGGAGG - Intronic
1065899377 10:30191494-30191516 TATCATTTTCTGCAGGCACTGGG + Intergenic
1068550731 10:58404951-58404973 ACTCATGGGCTGCAGGGATTAGG + Intergenic
1069651959 10:70055156-70055178 CCTCCTGTTCTGCTGGCAGGAGG - Intronic
1070242501 10:74696738-74696760 CCACATTTTCTGCAGTTATTGGG + Intronic
1070319280 10:75342732-75342754 CCCAATGTTCTGCTGGCACTGGG + Intergenic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1075548790 10:123376841-123376863 CCTCATGGGCTGGTGGCATTGGG - Intergenic
1076428364 10:130383430-130383452 CCTCATGTCCTGCTGGGAGTGGG + Intergenic
1076865100 10:133162583-133162605 TCACATGTTCAGCAGCCATTTGG - Intronic
1077134396 11:991354-991376 CCTCATGTTCTGGGGGCCTCAGG + Intronic
1078745565 11:14110677-14110699 CCTCAGGTTCTTCAGCCTTTGGG - Intronic
1079076347 11:17387530-17387552 CCTCATCTTCAGCAAGCATGCGG - Exonic
1082747502 11:56980993-56981015 CCTCAGGTTCTCCAGGAAGTGGG + Intergenic
1083125352 11:60559996-60560018 CCTCTTGGTGTGCAGGCAGTCGG - Intergenic
1084570260 11:69955499-69955521 CCTCCTGGTCTTCAGGGATTTGG - Intergenic
1088137399 11:106574476-106574498 CTTCATGATCAGTAGGCATTGGG + Intergenic
1089078514 11:115758312-115758334 TCTCCTTTTCTGCAGGCATCAGG + Intergenic
1089539097 11:119179271-119179293 TCTCATGTGCTGCAGACATTAGG - Intronic
1092731260 12:11537151-11537173 CTTTAAGTTCTGCATGCATTAGG - Intergenic
1094634871 12:32216232-32216254 CCATATACTCTGCAGGCATTTGG + Exonic
1096080949 12:48832078-48832100 CCCCATCTTCTCCAGGGATTTGG + Exonic
1096590744 12:52657654-52657676 CCTTAGGTTCTGGAGGCAGTTGG - Intergenic
1096601406 12:52732444-52732466 CCCCATCTTCTCCAGGGATTTGG - Intergenic
1097612904 12:61847702-61847724 GCTCATGCTCTGCAGACTTTTGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100317878 12:93462151-93462173 CCTCATGATCTGCCTGCCTTGGG + Intergenic
1102139686 12:110604509-110604531 TCTCATCTTCTGCAGAGATTGGG - Intergenic
1104628267 12:130377592-130377614 CCAGATGCTCTGCTGGCATTGGG + Intergenic
1106027533 13:25969223-25969245 GCTCATGTTCAGGAGGAATTAGG - Intronic
1107526851 13:41241276-41241298 CCTCATGATCTGCCTGCGTTGGG + Intronic
1108987808 13:56616139-56616161 ACTCATTTTCAGGAGGCATTGGG + Intergenic
1110046770 13:70841844-70841866 CCTCATGTCCTCCCGGCTTTTGG - Intergenic
1111245044 13:85526419-85526441 CCTCATGTTCAAGAGCCATTTGG + Intergenic
1113878292 13:113608145-113608167 CCACATGCCCTGCAGGCATGGGG + Intronic
1116632904 14:47356734-47356756 CTTCTTGTTCTGAATGCATTTGG - Intronic
1118232740 14:63968635-63968657 ACACATATTCTGCAGTCATTGGG + Intronic
1118713307 14:68540127-68540149 CCTCATGTCCTGGAGGCATTTGG - Intronic
1119041743 14:71280663-71280685 CCTAATGTTTAGCATGCATTAGG + Intergenic
1120112243 14:80570856-80570878 CCTCATTTTTAACAGGCATTAGG + Intronic
1120174417 14:81277972-81277994 CATCATGTCCTCCAGGCACTGGG - Exonic
1121065142 14:90956198-90956220 CCTCATTATCTGCAGGGAATTGG - Intronic
1121659586 14:95624776-95624798 CCTCATGGTCAGGAGGCAGTAGG + Intergenic
1121698020 14:95928590-95928612 TCTCATGCTCTGCAGGCAGCTGG - Intergenic
1124247984 15:28086970-28086992 CATCATCTTCTTCTGGCATTTGG - Intronic
1125746041 15:41997838-41997860 CCTCATAGTCTGCAGGCAGGTGG + Intronic
1126001418 15:44213812-44213834 CCACATCTACTGCAGGTATTTGG - Intergenic
1127919421 15:63481566-63481588 CCCAAAGTTATGCAGGCATTAGG - Intergenic
1129759087 15:78118356-78118378 CCTCATGATCTGCCCGCCTTGGG - Intronic
1130717693 15:86352013-86352035 CGTAATGTTGTTCAGGCATTGGG - Intronic
1131292334 15:91117609-91117631 CCTCATGTCCTCCTGCCATTTGG - Intronic
1133538726 16:6727023-6727045 CCTCATGACCTTCAGGTATTTGG + Intronic
1134897753 16:17904502-17904524 CTTCATGTTCTGGATGCTTTGGG - Intergenic
1135666135 16:24337100-24337122 CACCATGCCCTGCAGGCATTAGG + Intronic
1142913734 17:3116661-3116683 CTGCATGTTCTGCAGCAATTTGG - Intergenic
1142946488 17:3433584-3433606 CTGCATGTTCTGCAGCAATTTGG + Exonic
1143440800 17:6971949-6971971 CCTCATGATCTGCCCGCCTTGGG - Intronic
1147003651 17:37384029-37384051 CCTCATGTTCTGCCCGCCTCGGG - Intronic
1147261209 17:39210604-39210626 CCTCATGTACAGTGGGCATTGGG + Exonic
1150438566 17:65173154-65173176 CCTCATGATCTGCCGGCCTCAGG + Intronic
1152497091 17:80680924-80680946 CTTCGTGTTCAGCTGGCATTTGG + Intronic
1152794531 17:82300711-82300733 CCACACGTTCTGCATGCTTTGGG - Intergenic
1203169553 17_GL000205v2_random:135405-135427 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1155315842 18:24569207-24569229 CCTGATGTGCTGCAGGCTGTGGG - Intergenic
1156988652 18:43379678-43379700 CCTCATGTTCTGCCAGCCTCAGG - Intergenic
1157942709 18:51946502-51946524 CCTCCTGTTATGCAGACAGTGGG + Intergenic
1158055687 18:53277406-53277428 CCTCAGGTTGTGCTTGCATTTGG - Intronic
1160225929 18:77010514-77010536 CCTCATGCTCTGCAGAAAATCGG - Intronic
1163277534 19:16294788-16294810 CTTCATGTTCTGCATGTAGTCGG - Intergenic
1163957975 19:20661488-20661510 CCCCGTGTCCTGCAGGTATTGGG - Exonic
1164489325 19:28692284-28692306 CCTGAGGTTGTGCAGGCTTTGGG - Intergenic
1165987755 19:39785621-39785643 CCTCATGTTCCTCAGGAATTCGG - Intronic
926338986 2:11887988-11888010 CCTCATGTTCTGCCAACATCTGG + Intergenic
927715317 2:25348177-25348199 CTTTATGTTGTGGAGGCATTAGG - Intergenic
928386430 2:30872352-30872374 GCTCATGTTCTGCAGACTGTAGG - Intergenic
928511532 2:32009015-32009037 CCTCATAGTCTTCAGTCATTTGG - Intronic
929016085 2:37496717-37496739 CCTCATCTTCTGCTAGCTTTGGG + Intergenic
931653157 2:64486916-64486938 CCTTATGCTCTGCAGGCACTGGG + Intergenic
933255454 2:80075933-80075955 CCTCATTGTCTCCAGCCATTCGG - Intronic
934156614 2:89207112-89207134 CCTCCTTTTCTGCAGTCGTTCGG + Intergenic
934210701 2:89975639-89975661 CCTCCTTTTCTGCAGTCGTTCGG - Intergenic
936274694 2:111084382-111084404 CCTCATGTTATGCTGGGGTTTGG - Intronic
937135292 2:119546530-119546552 TCTCATGTTCAGCAGGCAGCTGG + Intronic
942303173 2:174582119-174582141 CCTCATGTCCTGTTGGCATGAGG + Intronic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
943931831 2:193864535-193864557 CCACTTGTTCTGTAGGAATTCGG + Intergenic
944966828 2:204944535-204944557 CCTGGTGTTCTTCAGGCATGTGG + Intronic
1169368319 20:5009100-5009122 CTTAATTTTCTGGAGGCATTTGG + Intronic
1171237720 20:23541178-23541200 CCACATGTTCTGCAGGACTCTGG + Intergenic
1172025272 20:31944124-31944146 CCTCATGCTCTGAAGGCAGAAGG - Exonic
1176402202 21:6323744-6323766 CCTCAAGCTCTACAGGCACTAGG + Intergenic
1176434955 21:6665360-6665382 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1176459217 21:6992430-6992452 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1176978554 21:15352425-15352447 AATCATGTTCTGGATGCATTTGG + Intergenic
1177639163 21:23824270-23824292 CCTCATGTTCTGCCCGCCTCAGG + Intergenic
1179416197 21:41200497-41200519 CCCCATGTTCTGCAGGTCTCAGG + Intronic
1180207766 21:46272665-46272687 CTTCAGGCTCTGCAGGCACTTGG + Exonic
1182444842 22:30384098-30384120 CCTCATGTTCTGCAGGCATTGGG - Intronic
1182697904 22:32208710-32208732 AGGCATGTGCTGCAGGCATTTGG + Intergenic
1183309259 22:37100631-37100653 CCTCATGGTCTGAAAGCATAGGG + Intronic
1183366724 22:37410848-37410870 CATCCTGTTCGGCAGGCAGTAGG + Intronic
1183732581 22:39627134-39627156 CCTGATGTCCTGCAGACACTGGG - Intronic
1183861383 22:40672865-40672887 CCTCATCTTCTGCAGCAATAAGG + Intergenic
1185070103 22:48651441-48651463 CCTTATATTCTCCAGGCATGAGG + Intronic
1185099604 22:48830662-48830684 GCTCATGTTCAGCGGGGATTGGG - Intronic
949233008 3:1773578-1773600 CCTCCTTCTCTGCAGGCACTAGG - Intergenic
950070766 3:10150443-10150465 GCTCATGATGTGCAGGCACTGGG - Exonic
950467354 3:13163211-13163233 TCTCTTGTTCTGCAGGCACCTGG + Intergenic
952711949 3:36440407-36440429 CCTGCTGTCCTGCAGGCATAAGG - Intronic
953877008 3:46672139-46672161 CATGATCTTCTGCAGGCACTCGG + Exonic
954743812 3:52775234-52775256 GCTCATCTCCTGCAGGGATTAGG - Intergenic
960518291 3:118626087-118626109 CCTCATGTTCCCCAAACATTTGG + Intergenic
962249319 3:133825696-133825718 GCTCCTGTTCTGCAGGCATCAGG - Exonic
962283149 3:134067030-134067052 CCTCATCTTCAGCAGGGCTTTGG - Intronic
962930266 3:140029467-140029489 ACTCAGGTCTTGCAGGCATTGGG - Intronic
964635437 3:158853200-158853222 CCTCATATACTGCAGGCAGCCGG - Intergenic
967303581 3:188039695-188039717 ACCCATGAACTGCAGGCATTTGG - Intergenic
969233553 4:5849162-5849184 CCTCATTGTCTTCAGGAATTGGG - Intronic
970960325 4:21863601-21863623 CCTCATTCTCTTCATGCATTGGG - Intronic
971009603 4:22418791-22418813 CCTCCTGTTCTGCAGGCACCAGG + Intronic
974708928 4:65562115-65562137 CATCATGTTCTGAAAGAATTTGG + Intronic
975113444 4:70652144-70652166 CCTAATGTTTTTCAGGTATTTGG - Intronic
975548366 4:75584437-75584459 CATTATTTTCTGGAGGCATTGGG - Intronic
977005692 4:91566914-91566936 TCTCATCTTCTGCTAGCATTGGG + Intronic
980608339 4:135122886-135122908 TCTCTTGTTGTGCAGGCAGTCGG + Intergenic
981700931 4:147606500-147606522 TCTGGTGTTCTGCAGACATTAGG + Intergenic
983898850 4:173111739-173111761 CCTCAATATCTACAGGCATTTGG + Intergenic
986276571 5:6280276-6280298 ACTCAGCATCTGCAGGCATTTGG - Intergenic
986291024 5:6398815-6398837 CCGCATGTTCAAAAGGCATTAGG - Intergenic
990285199 5:54294434-54294456 CTTAATGTTTGGCAGGCATTTGG - Intronic
990875852 5:60484689-60484711 CCTAATGTTATGAAGGCTTTTGG - Intronic
991193153 5:63899906-63899928 CTTCATGTTCTGTAGGCAGTTGG - Intergenic
991598264 5:68326618-68326640 CATCAACTTCTGCAGGCAGTCGG + Intergenic
992679119 5:79135660-79135682 CCCAATGTTCTGCAGGGAGTTGG - Intronic
993188001 5:84645372-84645394 CCTCATGATTCACAGGCATTTGG - Intergenic
994067121 5:95555463-95555485 CCGCCTGTGCTGCAGGCTTTGGG + Intronic
995430350 5:112067774-112067796 CCTCATGATTTCCAGGGATTAGG + Intergenic
995819754 5:116216766-116216788 CCTCATGATCTGCCTGCCTTAGG + Intronic
997417368 5:133739409-133739431 CTTGATGTTCTGCTGGCAGTGGG - Intergenic
997574019 5:134959025-134959047 CTTCATCTTATGCAGGCATTTGG + Exonic
998055217 5:139069827-139069849 CTTCATCTTCTGCTGGCAGTAGG - Intronic
998445866 5:142197986-142198008 CCTCTTATTCTGCAGGCAGTGGG - Intergenic
1001226866 5:169952301-169952323 CCTGATGCACTGCTGGCATTGGG + Intronic
1002647428 5:180667076-180667098 CATAATGTTCTGCATGCACTTGG + Intergenic
1002724842 5:181287858-181287880 CCTGATGCACTGCTGGCATTGGG + Intergenic
1004841234 6:19587338-19587360 CATTATGTTCTGGAGGCACTGGG - Intergenic
1005153717 6:22780223-22780245 CCACATGTTGTGCAGGAATGTGG + Intergenic
1005576137 6:27191170-27191192 CCTCATGATCTGCCCGCCTTGGG - Intergenic
1007649493 6:43409590-43409612 CCTCATGATCTGCCGGCCTCGGG - Intergenic
1008624291 6:53302394-53302416 CCTCATGTTCTGTTGTCCTTGGG - Intronic
1009399566 6:63238167-63238189 CCTGATGTTCTGCTGGCATGAGG - Intergenic
1014188217 6:118459843-118459865 CCTCAATTTCTACAGGCAGTTGG - Intergenic
1018816968 6:167340379-167340401 CCTCATGTGCTTCAGGTGTTTGG - Exonic
1019912096 7:4106890-4106912 CCTCATCTTGTTCAGGCACTGGG - Intronic
1022127451 7:27372175-27372197 GCTCAAGTTCTGCAGGCTGTAGG + Intergenic
1032015199 7:128375341-128375363 CCTCATGATCTGCCTGCCTTGGG - Intergenic
1038532998 8:28333810-28333832 GCTCCTGTTCTGCAAGGATTGGG + Intronic
1039275037 8:35926019-35926041 CCTTATCATCTGCAGGCATCTGG + Intergenic
1039573170 8:38603099-38603121 CCTCATGGTTTGCAGGAATGTGG - Intergenic
1042818625 8:72905843-72905865 CCTGATGGTCTGGTGGCATTTGG - Intronic
1046769438 8:118103500-118103522 CCTTAGGTCCTGGAGGCATTGGG + Intronic
1048727523 8:137403422-137403444 TCTCATCTTCTGCTAGCATTGGG - Intergenic
1048881350 8:138875230-138875252 GCCCATGTTCTGGAGGCATGGGG + Intronic
1049145732 8:141000522-141000544 CCTTTTGTTTTTCAGGCATTGGG + Intronic
1049741777 8:144244514-144244536 AATCATGATCTGCAGGCCTTGGG - Exonic
1050045868 9:1544657-1544679 CCAGATTTTCTGCAGGCATTTGG - Intergenic
1050128244 9:2382071-2382093 CATGATGTTCTGCATGCATCCGG + Intergenic
1050878497 9:10671353-10671375 TCTCATCTTCTGCAGGTTTTTGG + Intergenic
1051354919 9:16232589-16232611 CCTAATGCCCTGAAGGCATTAGG - Intronic
1057296744 9:93849787-93849809 CCTCATGATCTGCCCGCCTTGGG + Intergenic
1061384511 9:130280869-130280891 CCTCATGATCCGCCTGCATTGGG - Intergenic
1203436581 Un_GL000195v1:143287-143309 CCTCAAGCTCTACAGGCACTAGG + Intergenic
1185641935 X:1593130-1593152 CTTCCTATTCTGCAGGCCTTGGG + Intronic
1189220354 X:39366631-39366653 TCTCATGCTCTGCAGGAACTAGG + Intergenic
1192227283 X:69238132-69238154 CCTCCGTTTCTGCAGGCTTTAGG - Intergenic
1192625700 X:72725687-72725709 CCTCATGATCTGCCTGCCTTGGG + Intergenic
1192892201 X:75402357-75402379 TCTCATTTTCTGCTAGCATTTGG - Intronic
1193794251 X:85853663-85853685 CCTCAATTTCCGCATGCATTTGG - Intergenic
1194832204 X:98637517-98637539 CCTCATCTTCTGCAGTCCTAAGG - Intergenic
1198770943 X:140129394-140129416 CCTCATATTTAGCATGCATTAGG + Intergenic