ID: 1182451188

View in Genome Browser
Species Human (GRCh38)
Location 22:30422919-30422941
Sequence GGCTTTTCCCAGGTCTCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 1, 2: 2, 3: 46, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182451181_1182451188 12 Left 1182451181 22:30422884-30422906 CCAAACATTTTAGCACTGAGGCT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1182451188 22:30422919-30422941 GGCTTTTCCCAGGTCTCAGGAGG 0: 1
1: 1
2: 2
3: 46
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182451188 Original CRISPR GGCTTTTCCCAGGTCTCAGG AGG Exonic
901340980 1:8499106-8499128 GACTTTTCACAGGTCTCTGCTGG - Intronic
901860674 1:12072510-12072532 AGCTTTGCCCAGGGCTCTGGAGG + Intronic
902087441 1:13874355-13874377 TGCCTCTCCCACGTCTCAGGAGG + Intergenic
904094302 1:27965673-27965695 AGCCTTGCCCAGGTCTCAGCAGG - Intronic
904604293 1:31690475-31690497 GGCTCTTCCAAGGCCTCTGGAGG - Intronic
904849864 1:33449770-33449792 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
905497740 1:38407272-38407294 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
907220360 1:52903062-52903084 GGCTTCTCCCAACTCTCAGGGGG - Intronic
907654637 1:56329771-56329793 GGCTTTACTCAGGTCACAGCTGG + Intergenic
907701095 1:56788976-56788998 TGCTGTTCCCAAGACTCAGGGGG - Exonic
908257927 1:62318191-62318213 GACTTTGCCCAGGCCTCAGGGGG + Intronic
908791796 1:67790204-67790226 GGCTTTACCCAGGAAGCAGGTGG - Intronic
908883733 1:68763145-68763167 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
909404582 1:75273445-75273467 GTCTTTTTCCAGTTCTCAGGGGG + Intronic
909828036 1:80150510-80150532 GTCTTTTTTCAGTTCTCAGGGGG + Intergenic
910769758 1:90818907-90818929 GGATCTCTCCAGGTCTCAGGTGG + Intergenic
911265572 1:95739177-95739199 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
911360707 1:96873055-96873077 GGATTTACTGAGGTCTCAGGTGG + Intergenic
911743584 1:101414626-101414648 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
911900270 1:103494760-103494782 GCCTTGTTCCAGGTCTCAAGGGG - Intergenic
912180719 1:107216215-107216237 GTCTTATTCCAGTTCTCAGGGGG + Intronic
913402593 1:118453064-118453086 GTCTTGTTCCAGTTCTCAGGTGG - Intergenic
914808491 1:151008907-151008929 GACTTCTCCCCGCTCTCAGGCGG - Intronic
915560151 1:156682363-156682385 TGCTTTTCCCCGGCCACAGGAGG + Intergenic
916331345 1:163620926-163620948 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
917317243 1:173738562-173738584 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
917453092 1:175163462-175163484 GGCTGTTCCCAGGCCTCAGAGGG - Intronic
917590856 1:176475521-176475543 AGTTATTCCCAGGTATCAGGAGG - Intronic
917698596 1:177556131-177556153 GGCTTTTCTGATGTCTCAGATGG - Intergenic
917746595 1:178014791-178014813 GTCTTGTCCCAGTTCTCAAGGGG + Intergenic
917924675 1:179779312-179779334 GGCTTAGACCAGGGCTCAGGGGG + Intronic
918005800 1:180541078-180541100 TGCTGTCACCAGGTCTCAGGAGG - Intergenic
918819448 1:189233490-189233512 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
919278194 1:195448337-195448359 GTCTTTTTCCAGTTCTCAGAGGG - Intergenic
919431001 1:197491589-197491611 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
919485359 1:198139606-198139628 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
920768933 1:208861700-208861722 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
921116346 1:212095161-212095183 GTCTTTTTCCAGTTCTCATGGGG + Intronic
921497044 1:215854409-215854431 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
923174485 1:231450682-231450704 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
923442488 1:234034411-234034433 GTCTTGTTCCAGGTCTCAGGTGG + Intronic
924579817 1:245314047-245314069 CTCTTTGTCCAGGTCTCAGGAGG + Intronic
924885073 1:248206368-248206390 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1063817122 10:9788168-9788190 GCCTTTTCCCTGGCCTCTGGTGG + Intergenic
1064556888 10:16555817-16555839 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1065156883 10:22879337-22879359 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1065910352 10:30298423-30298445 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
1066706484 10:38184845-38184867 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1066784544 10:38988877-38988899 GTCTTTTTCCAGTTCTCAGGGGG - Intergenic
1067233799 10:44430391-44430413 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1067810840 10:49426035-49426057 GCCTCTTCCCAGGGCTCAGAGGG + Intergenic
1068011068 10:51452359-51452381 GTCTTTTTTCAGTTCTCAGGGGG + Intronic
1068122527 10:52797737-52797759 GCCTTGTCTCAGTTCTCAGGGGG + Intergenic
1069648543 10:70023941-70023963 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1070547683 10:77465406-77465428 GGCTTTTCCCAGGTCTTAAAAGG + Intronic
1070708482 10:78658765-78658787 GACTTGTCCAAGGTCACAGGAGG + Intergenic
1071170065 10:82853866-82853888 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
1072797296 10:98365830-98365852 GGCTGTGGCCAGGCCTCAGGAGG - Intergenic
1072885657 10:99271058-99271080 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1074149114 10:110742344-110742366 GCCTTTTCCCAGGTCTCTAATGG + Intronic
1075438890 10:122463840-122463862 TGCTGTTCCCAGCTCTGAGGGGG - Intronic
1075660283 10:124189651-124189673 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1076125383 10:127970116-127970138 GGCTTTTCCCAGGCCCCCAGTGG + Intronic
1076328165 10:129644557-129644579 GGCTCTCACCAGGCCTCAGGGGG - Intronic
1077539401 11:3139504-3139526 GGCTTTCCCCAGCTCACTGGAGG - Intronic
1077869670 11:6251260-6251282 TGCTTGTCCCAGGCCTCTGGCGG + Intergenic
1078090067 11:8259552-8259574 GGCCTTTACCAGGCCTCAGCAGG + Intronic
1078686976 11:13541797-13541819 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1078724357 11:13916196-13916218 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1078991510 11:16651696-16651718 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1079668573 11:23136611-23136633 TGCTTTTCCCAGTTCTCTGTGGG + Intergenic
1079690073 11:23406546-23406568 GGCAGATCCCAGGTCTCACGAGG - Intergenic
1079770735 11:24455399-24455421 GGCTTTTCAGGGGTCACAGGTGG - Intergenic
1080670117 11:34368359-34368381 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1081662486 11:44896574-44896596 GGCTGTGGCCATGTCTCAGGAGG + Intronic
1082029512 11:47594295-47594317 TGCTTTTCCCGGCTCTGAGGCGG + Exonic
1082104376 11:48204643-48204665 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1082668362 11:56003942-56003964 GTCTTATCCCAGTTCTCAGAGGG - Intergenic
1083087626 11:60167144-60167166 GCCTTTTTCCAGTTCTCAGGGGG + Intergenic
1083162305 11:60862257-60862279 GACTTTTCCAAGGTCTCCAGTGG + Intergenic
1084750822 11:71203652-71203674 GGATATTCCCAGGGCTCAGAGGG - Intronic
1084975184 11:72793162-72793184 GGCTTGCCCCAGGTCTCAGCAGG - Exonic
1085488957 11:76896029-76896051 GGGTTTTCCCAGGTCTTAGTTGG - Intronic
1085694610 11:78693495-78693517 CTGTTTTCCCAAGTCTCAGGTGG + Intronic
1085783254 11:79428627-79428649 GGCATTTCCCAGCACTCAGAAGG + Intronic
1086511921 11:87567852-87567874 GTCTTCTTCCAGTTCTCAGGGGG - Intergenic
1086513573 11:87587248-87587270 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1087400499 11:97659520-97659542 GGCAGTTGCCAGGGCTCAGGAGG - Intergenic
1087731340 11:101781571-101781593 GTCTTGTTCCAGTTCTCAGGCGG + Intronic
1088346357 11:108830615-108830637 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1088413481 11:109563503-109563525 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1089296947 11:117475125-117475147 GCCATTTCCCTGGTCTAAGGAGG - Intronic
1089784893 11:120900880-120900902 GGCTGTTCCCAGCTCTCTGCTGG - Intronic
1090757875 11:129810142-129810164 GGCTTGTTCCAGTTCTCAGGGGG - Intergenic
1091222450 11:133937280-133937302 GCGTTTTCCCAGGGCTCAGCTGG - Intronic
1092202075 12:6591683-6591705 ATCTTTTCCCAGGTATCATGTGG - Exonic
1093342685 12:17998175-17998197 GGCTTGCCCCAGGTGTCAGAGGG + Intergenic
1093964078 12:25307126-25307148 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1095111622 12:38300807-38300829 GCCTTGTTCCAGTTCTCAGGGGG - Intergenic
1095557751 12:43527760-43527782 GCCTTGTTCCAGTTCTCAGGGGG - Intronic
1095784823 12:46098478-46098500 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1097490567 12:60264409-60264431 GGCTTGTTCCAGTTCTCAGGGGG + Intergenic
1097603718 12:61726793-61726815 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1098520830 12:71433542-71433564 GTCTTATTCCAGTTCTCAGGGGG - Intronic
1099120160 12:78679537-78679559 GGCTTTCTCCAGGACGCAGGTGG - Intergenic
1099386804 12:82023794-82023816 GTCTTTTTCCATTTCTCAGGGGG - Intergenic
1100918855 12:99459331-99459353 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1100937333 12:99684032-99684054 GTGTTATCCCAGGTCTCAGGGGG - Intronic
1101634934 12:106531842-106531864 GTCTTTTTCCAGTTCTCAGAGGG + Intronic
1103541398 12:121669029-121669051 TGCTTAACCCAGGTCTCAGAAGG + Intronic
1103893675 12:124258651-124258673 GGCTCTGCCCAGGTTGCAGGAGG + Intronic
1104192919 12:126500686-126500708 GTCTTGTTCCAGGTCTCAAGGGG - Intergenic
1104707729 12:130960002-130960024 AGCTTTTCCAGGGCCTCAGGCGG + Intronic
1104896649 12:132168150-132168172 GGCTCTTCCCAGGTCAGAGCTGG + Intergenic
1105399028 13:20071625-20071647 CCCTTCTGCCAGGTCTCAGGTGG - Intronic
1105598553 13:21863546-21863568 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1105986770 13:25575188-25575210 GGCGTTTCCCAAGTCCCATGAGG + Intronic
1105990068 13:25611214-25611236 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1106325661 13:28686196-28686218 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1106652204 13:31703699-31703721 GGCTTTTCCCAGGGGAAAGGTGG + Intergenic
1107641688 13:42450389-42450411 GTCTTTTTCCAGCTCTCAGGGGG - Intergenic
1108815007 13:54279755-54279777 GGCTTTTTCCAGTTCCGAGGGGG + Intergenic
1109419163 13:62087822-62087844 GTCTTTGCCCCTGTCTCAGGTGG + Intergenic
1109484871 13:63005711-63005733 GTCTTTTTCCAGTTCTCAGGGGG - Intergenic
1109548492 13:63860529-63860551 GGCTATCCCCAAGTCTCAGATGG - Intergenic
1110340330 13:74383083-74383105 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1110375679 13:74791159-74791181 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1110803609 13:79729220-79729242 GTCTTTTTCCAGTTCTTAGGGGG + Intergenic
1111768699 13:92568768-92568790 TGATTTTCCCAGTTCTAAGGTGG - Intronic
1112435181 13:99386813-99386835 GGCTTTGCTCAGCACTCAGGAGG - Intergenic
1112721435 13:102250303-102250325 GACTTCTCCCAGGTCAGAGGAGG - Intronic
1113175832 13:107562868-107562890 GGCATTTCCCAGTTCCCATGAGG + Intronic
1113240629 13:108332894-108332916 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1113408309 13:110062217-110062239 GGTTTTACCAAGGCCTCAGGTGG - Intergenic
1113534587 13:111055144-111055166 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1114867562 14:26615840-26615862 GTCTTGTCCCAGTTCTCAAGGGG - Intergenic
1115392902 14:32873693-32873715 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1115526851 14:34289483-34289505 GTCTTTTTCCAGTTCTCAGAGGG + Intronic
1116064240 14:39962352-39962374 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1116077926 14:40135621-40135643 TGCTTATTCCAGTTCTCAGGGGG + Intergenic
1116695258 14:48167225-48167247 GACTTGTTCCAGTTCTCAGGAGG - Intergenic
1116741396 14:48759692-48759714 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1118162632 14:63305759-63305781 GTCTTTTTCCAGTTCTCAGAGGG - Intergenic
1118651939 14:67905964-67905986 GCCTTGTTCCAGGTCTCAAGGGG + Intronic
1119434647 14:74589970-74589992 GGCTGTTCTCAGGGCTCAGGAGG - Intronic
1119739392 14:77004348-77004370 AGCTCTTCCCTGGGCTCAGGTGG - Intergenic
1121575758 14:94985258-94985280 GACTTTTTCCTGTTCTCAGGGGG - Intergenic
1121720572 14:96105889-96105911 AGCCTTGCCCAGGTCTCAGAGGG - Intergenic
1121749530 14:96338354-96338376 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1122313565 14:100812578-100812600 GGCTCTTCCCAGGTCCCAGGAGG + Intergenic
1122313697 14:100813266-100813288 GACTCTTCCCAGGTCCCAGGAGG - Intergenic
1122879713 14:104685262-104685284 GGCTTATCCCTGGTCTGAGGAGG - Intergenic
1124502137 15:30237892-30237914 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1124741426 15:32300760-32300782 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1126183020 15:45804364-45804386 GGATTTTCCCAAGTCTCACCAGG - Intergenic
1126184341 15:45816584-45816606 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1126488231 15:49206906-49206928 GTCTTGTCCCAGTTCTCAGAGGG + Intronic
1126516480 15:49544573-49544595 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1126566250 15:50103166-50103188 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1126577879 15:50214887-50214909 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1126659875 15:51022380-51022402 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1127573641 15:60268743-60268765 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1127762586 15:62153383-62153405 GGCTTTGCCCACGTCTGAAGAGG + Intergenic
1128258476 15:66215348-66215370 GGAGGTTCCCAGGGCTCAGGTGG - Intronic
1128850609 15:70951829-70951851 GTCTTTTTCCAGTTCTCAAGGGG + Intronic
1129617189 15:77107889-77107911 TGCTTTTCCCAGACCTCAGAAGG - Exonic
1129672158 15:77613402-77613424 GGCTTTTTGCAGGGCGCAGGTGG - Exonic
1130605224 15:85309931-85309953 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
1132568284 16:633053-633075 TGCTTCTCCCAGGTCACAGCAGG - Exonic
1132597710 16:760865-760887 GGCCCCTCCCAGGTCTCAGTGGG - Intronic
1132939477 16:2499740-2499762 GGCCTGTCCCAGGTCACAGGTGG - Intronic
1133250265 16:4476264-4476286 GGCTTTCCCCAGGTCTCTGGAGG - Exonic
1135719203 16:24800683-24800705 GCCTTTTCCCAGGACTCTAGAGG - Intronic
1135788801 16:25374752-25374774 GCCTTCTGCCAGGTCTCAGATGG + Intergenic
1135796177 16:25445009-25445031 CTCTCCTCCCAGGTCTCAGGAGG - Intergenic
1136552919 16:30991039-30991061 GTCCTCTCCCAGGTCTGAGGTGG + Exonic
1138312751 16:56042047-56042069 TGCTTATCCCAGGTATCAGAGGG - Intergenic
1138516914 16:57541250-57541272 GGCTATTCTTAGGGCTCAGGAGG - Intergenic
1139327435 16:66163366-66163388 GGACTTTCTCTGGTCTCAGGAGG - Intergenic
1140620017 16:76718463-76718485 GTCTTTTTCCAGTTCTCAGAGGG - Intergenic
1141592378 16:85077442-85077464 GGCTTCTCCCGGGACTCCGGGGG - Exonic
1142275178 16:89114672-89114694 GCCTTCTCCCAAGTCTCAGTCGG + Intronic
1142593551 17:1018565-1018587 GTCCCTTCCCAAGTCTCAGGGGG + Intronic
1142671312 17:1488567-1488589 GACTTGTGCAAGGTCTCAGGAGG + Intronic
1142939340 17:3369305-3369327 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1144438409 17:15261227-15261249 GGCTGTCTCCAGGTCTCAGACGG - Intronic
1144622450 17:16826224-16826246 GGCTTTTCTCAGATGTCTGGTGG - Intergenic
1145002439 17:19314667-19314689 GGCTTTTCCCAAGGCCCAGAGGG - Intronic
1145148256 17:20497891-20497913 GGCTTTTCTCAGATGTCTGGTGG - Intergenic
1145237904 17:21222022-21222044 TGCCTTTCCCATGTCTGAGGTGG - Intergenic
1145359041 17:22196624-22196646 GTCTTATTCCAGTTCTCAGGAGG + Intergenic
1146583722 17:34063441-34063463 GGCTTGTTCCAGTTCTCAGAGGG - Intronic
1146671543 17:34741339-34741361 GTCTTCTCCCAGGTCACAGTGGG + Intergenic
1146745546 17:35325549-35325571 GCCTTGTTCCAGTTCTCAGGAGG - Intergenic
1147978758 17:44262208-44262230 GGCCTGTCCAAGGTCTTAGGTGG - Intronic
1148017325 17:44531230-44531252 GGCTTTCCCAAGGTATCAGTCGG - Intergenic
1148067542 17:44883467-44883489 GGCTTTTCCCAAGCAGCAGGTGG - Intronic
1150586838 17:66526530-66526552 TGCTCTTCCCAGGGCTAAGGGGG + Intronic
1151654681 17:75490354-75490376 GGTTTTTCCAAGGTGTCTGGGGG + Intronic
1151684567 17:75639189-75639211 GCCTTGTCCCAGGTCTCAGCCGG - Exonic
1152548987 17:81019921-81019943 GCCTTTTCCCAGGTCCGGGGTGG + Intergenic
1153071566 18:1111926-1111948 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1153168597 18:2290002-2290024 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1153532679 18:6064918-6064940 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1153576677 18:6528707-6528729 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1154090324 18:11353158-11353180 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1155547441 18:26929941-26929963 TGCTGCTCCCAGGACTCAGGTGG - Intronic
1156252277 18:35362187-35362209 AGCTTTTCCCAGAAGTCAGGGGG + Intergenic
1157429805 18:47615357-47615379 GGCATTACCCAGTTCACAGGTGG - Intergenic
1158313840 18:56188892-56188914 GGGTTTTCACAGGCCCCAGGAGG - Intergenic
1160543405 18:79637916-79637938 GGCGCCGCCCAGGTCTCAGGGGG + Intergenic
1160735664 19:661307-661329 GGCCTGTCCCAGGGCTCAAGGGG + Intronic
1161395423 19:4042785-4042807 GGCTTTCCCGAGGCCCCAGGCGG - Intergenic
1161631017 19:5355511-5355533 GGCTGTCCCTAGGTCTCTGGTGG + Intergenic
1162315714 19:9936770-9936792 GGCATTTCCCACGTTGCAGGTGG + Intergenic
1162390381 19:10386254-10386276 GGGGTTTCCCAGGACTGAGGGGG + Intergenic
1162390429 19:10386430-10386452 GGCTTTTCCCAGGTCCCAGGGGG - Intergenic
1163003896 19:14385551-14385573 GGCGGTTCCCAGCACTCAGGGGG - Intronic
1163620545 19:18357304-18357326 GCCTTTTCCCTGGCCTCAGGGGG + Intronic
1164324193 19:24178161-24178183 GCCTTTTTCCAGGACTCACGAGG + Intergenic
1164612597 19:29642997-29643019 GGGTTTTCCCAGGACTAACGAGG + Intergenic
1164623440 19:29711507-29711529 GGCACTGCCCAGGTCTCAGGAGG + Intronic
1164943905 19:32274066-32274088 GGCCTTTTCAAGGTCTCAGCTGG - Intergenic
1167928891 19:52847454-52847476 GGCTCTTTACAGGTGTCAGGCGG - Intronic
1168115129 19:54218100-54218122 AGCTCTCCCCAGGCCTCAGGAGG - Intronic
1168120826 19:54251792-54251814 AGCTCTCCCCAGGCCTCAGGAGG - Intronic
1168177581 19:54635849-54635871 AGCTCTCCCCAGGCCTCAGGAGG + Intronic
925447652 2:3941608-3941630 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
926150135 2:10421102-10421124 GGCTTTCCCCAGGTCTTGGCAGG - Intronic
927094242 2:19735563-19735585 GTCTTTTCCCAAGTCTGAGCTGG + Intergenic
927345994 2:22041422-22041444 GTCTTGTCCCTGGTCTCAGAGGG - Intergenic
927355572 2:22169190-22169212 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
927722422 2:25393304-25393326 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
928446776 2:31339819-31339841 GGGTTATCCCAGGGCTGAGGCGG - Intronic
928988797 2:37208715-37208737 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
929586814 2:43121437-43121459 GGATTATCACAGGTCACAGGAGG + Intergenic
930423389 2:51181548-51181570 GACTTGTTCCAGTTCTCAGGGGG - Intergenic
931423013 2:62145267-62145289 GGCTGTTTCTAGGTCACAGGTGG - Intronic
931536183 2:63279532-63279554 GTCTTTTTCCAGTTCTCAGGGGG - Intronic
931834960 2:66089324-66089346 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
932307817 2:70716336-70716358 GGCTATTCCCAGGACCCAAGAGG + Intronic
933832821 2:86224483-86224505 GGCTTTCCCAAGGCCTCAGAGGG + Intronic
933904714 2:86880104-86880126 GTCTTCTTCCAGTTCTCAGGGGG - Intergenic
934111051 2:88743106-88743128 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
935001037 2:99015571-99015593 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
936367521 2:111872060-111872082 GTCTTCTTCCAGTTCTCAGGGGG + Intronic
936633677 2:114232222-114232244 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
937172422 2:119888414-119888436 GTCTTTTTCCAGTTCTTAGGGGG + Intronic
937411029 2:121675769-121675791 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
937699222 2:124845046-124845068 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
937828630 2:126395712-126395734 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
937854554 2:126662980-126663002 GGCCTTTCCCTGGTCTCTGTGGG - Intronic
938734170 2:134171411-134171433 TTCTTGTCCCAGGTCTCAGGAGG - Intronic
938853687 2:135288001-135288023 GCCTTGTTCCAGTTCTCAGGGGG + Intronic
938960774 2:136339148-136339170 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
939449525 2:142355513-142355535 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
939756119 2:146114341-146114363 GGTGTTTACCAGGGCTCAGGGGG + Intergenic
940757779 2:157703463-157703485 GTCTTTTTCCAGTTCTTAGGGGG - Intergenic
940802584 2:158149356-158149378 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
940852467 2:158701604-158701626 GTCTTTACCCTGGTCTCAGCAGG - Intergenic
941419751 2:165268608-165268630 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
941498696 2:166240973-166240995 CCCTTTACCCAGGTCTCATGGGG - Intronic
942405688 2:175651933-175651955 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
942495260 2:176533489-176533511 GGCTCTTTCCAGGACTGAGGAGG + Intergenic
943943834 2:194032966-194032988 GTCTTGTTCCAGGTCTCAGGGGG - Intergenic
944069332 2:195652106-195652128 GGCTGGTTCCAGGTCTTAGGTGG + Intronic
944262752 2:197694876-197694898 GCCTTGTTCCAGTTCTCAGGGGG + Intronic
944436938 2:199699972-199699994 GTCTTGTCCCAGTTCTCAAGAGG - Intergenic
945028793 2:205644207-205644229 AGCCTTTCCCAGGTCCCAGATGG + Intergenic
946204956 2:218098271-218098293 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
946310067 2:218878327-218878349 GGCTCTGCCCTGGTGTCAGGAGG - Intergenic
946636060 2:221728405-221728427 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
947460859 2:230303829-230303851 GTCTTGTTCCAGGTCTCAGAGGG - Intronic
948416040 2:237804918-237804940 GTCTTGTTCCAGTTCTCAGGAGG - Intronic
948637643 2:239349622-239349644 GCCTCTGCCCACGTCTCAGGCGG - Intronic
948696456 2:239735411-239735433 GGCTTTTCGCAGGTCCCGGGTGG - Intergenic
1169616181 20:7448341-7448363 GCCTTTTTCCAGTTCTCAGGGGG + Intergenic
1169969766 20:11256960-11256982 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1170126985 20:12974694-12974716 GTCTTGTCCGAGTTCTCAGGGGG + Intergenic
1170865691 20:20154278-20154300 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1170977897 20:21183803-21183825 GGCTTTGCCCAAGCCTCAGATGG + Intronic
1171438695 20:25144096-25144118 GCCCTTTCCAAGGTCTTAGGAGG + Intergenic
1171721342 20:28566241-28566263 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1171753340 20:29077188-29077210 GTATTTTCCCAGTTTTCAGGTGG - Intergenic
1171756728 20:29117318-29117340 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1171862776 20:30416581-30416603 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1173337288 20:42123049-42123071 GGCATGTCCCATGTCCCAGGAGG - Intronic
1174046765 20:47739317-47739339 GGCCTTCCCCAGATCCCAGGAGG - Intronic
1174447647 20:50601626-50601648 GGCTGTTCTCAGTTCACAGGAGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175880597 20:62256381-62256403 GGCTTTTCCCACCTCTGAGATGG - Intronic
1176872546 21:14095445-14095467 GGCTTTCTCCAGCTCTCAGCAGG + Intergenic
1177133048 21:17280159-17280181 GACTTTCCCCAGGCCTAAGGTGG - Intergenic
1177661502 21:24089516-24089538 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1179268545 21:39828410-39828432 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1180294885 22:10924900-10924922 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1180410136 22:12599247-12599269 GTATTTTCCCAGTTTTCAGGTGG - Intergenic
1180413781 22:12641161-12641183 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1181673777 22:24438890-24438912 TGCTATTACCAGATCTCAGGTGG - Intronic
1182451188 22:30422919-30422941 GGCTTTTCCCAGGTCTCAGGAGG + Exonic
1182664313 22:31945761-31945783 GGATCCTCCCAGGTCTCAGGAGG - Intronic
1183540979 22:38429315-38429337 CGCTATTCCCATGTCCCAGGTGG + Intronic
1184088207 22:42278578-42278600 GGCTTAGCCCAGGGCACAGGAGG + Intronic
1184566577 22:45295614-45295636 GGCTGTTCCCAAGTCGCTGGGGG + Exonic
1184852244 22:47127721-47127743 CACTTTTCCCAGGTAGCAGGAGG + Intronic
950841351 3:15970902-15970924 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
951234909 3:20223379-20223401 AGCATTGCTCAGGTCTCAGGGGG - Intergenic
951766988 3:26210981-26211003 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
952265439 3:31781385-31781407 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
952434863 3:33263079-33263101 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
953277067 3:41512202-41512224 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
954199278 3:49014581-49014603 GTCTTTTCCTGGCTCTCAGGAGG + Exonic
954453279 3:50583217-50583239 TGCTTTTCCCAGTTGTCAGTGGG + Exonic
954479523 3:50785386-50785408 GTCTTGTTCCAGTTCTCAGGTGG + Intronic
954684092 3:52361247-52361269 GGCCTTACCCAGGTCTTTGGTGG - Exonic
955686278 3:61551967-61551989 GTCTTGTCCCAGTTCTCAGGGGG + Intergenic
955843166 3:63133215-63133237 GGCTGTTGCCAGGTCTGAGTTGG - Intergenic
956377059 3:68625117-68625139 GTCTTGTCCCAGTTCTTAGGGGG + Intergenic
956950591 3:74277689-74277711 GTCTTTTTCCAGTTCTCAGAGGG - Intronic
957921420 3:86753362-86753384 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
959424139 3:106165333-106165355 GTCTTCTTCCAGTTCTCAGGGGG - Intergenic
959721972 3:109501924-109501946 GTCTTGTTCCAGTTCTCAGGTGG + Intergenic
959745392 3:109770432-109770454 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
960139257 3:114136556-114136578 GGCTGATCCAAGGTCTAAGGAGG - Intronic
960152706 3:114266875-114266897 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
960558243 3:119053068-119053090 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
960711420 3:120533781-120533803 GCCTTTTTCCAGTTCTTAGGAGG + Intergenic
960756785 3:121022828-121022850 ATCTTTTTCCAGTTCTCAGGGGG - Intronic
961631127 3:128299608-128299630 GGCCTTCCCCATGTGTCAGGTGG - Intronic
962598984 3:136976299-136976321 GGCAATCCTCAGGTCTCAGGTGG + Intronic
963325635 3:143859800-143859822 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
964075978 3:152692376-152692398 GTCTTCTTCCAGTTCTCAGGGGG - Intergenic
964109109 3:153070934-153070956 GACTTGTCCAAGGTCTCATGTGG + Intergenic
964388037 3:156170034-156170056 GGCTTTTCTCTGGGCTCAGAAGG + Intronic
964393942 3:156225493-156225515 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
964772999 3:160244241-160244263 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
965014943 3:163146078-163146100 GTCTTGTTCCAGGTCTCAGAGGG + Intergenic
965228236 3:166019412-166019434 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
966552963 3:181225983-181226005 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
966640637 3:182185956-182185978 AGCTTTTCCCAGCTCTTAGTGGG + Intergenic
967635535 3:191798042-191798064 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
968499144 4:938112-938134 GGCTTGTTCCTGGTCTTAGGGGG - Intronic
969323088 4:6424785-6424807 GACGTGTCCCAGGTCTCATGGGG - Intronic
969533083 4:7740339-7740361 GGCTTTCCGCAGGTCTCTGAGGG - Exonic
969568352 4:7993215-7993237 GGCTTGGCCCAGGTGCCAGGTGG - Intronic
971080770 4:23208270-23208292 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
971237893 4:24859519-24859541 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
971554654 4:27998513-27998535 GACTTGTTCCAGTTCTCAGGGGG + Intergenic
973582917 4:52361974-52361996 GACTTTTTCCAGGTCACAGGAGG - Intergenic
974127429 4:57713772-57713794 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
974656656 4:64832648-64832670 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
974966260 4:68763962-68763984 GCCTTTTTCCAGTTCTCAAGAGG + Intergenic
975068313 4:70098190-70098212 GCCTTGTTCCAGTTCTCAGGGGG - Intergenic
975670669 4:76777664-76777686 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
976079550 4:81340052-81340074 GTCTTTTTCCAGTTCTTAGGGGG + Intergenic
977332523 4:95655476-95655498 GTCTTTTCCCAGTTTTCAAGGGG + Intergenic
977552096 4:98452864-98452886 GTCTTGTCCCAGTTCTCAGGGGG + Intergenic
977834092 4:101628773-101628795 GGCTTGTTCCAATTCTCAGGGGG + Intronic
977906909 4:102487510-102487532 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
977929978 4:102739865-102739887 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
978163375 4:105576739-105576761 GTCTTTTTCCAGTTCACAGGAGG + Intronic
978199553 4:106009585-106009607 GTCTTTTTCCAGCTCTCAAGGGG + Intergenic
978757566 4:112320112-112320134 GTCTTGTTCCAGATCTCAGGGGG + Intronic
979295572 4:119029833-119029855 TGCTTTCCCTAGGGCTCAGGAGG + Exonic
979691855 4:123567828-123567850 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
979712323 4:123794414-123794436 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
979984798 4:127300437-127300459 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
980019675 4:127693641-127693663 GTCTTGTTCCAGTTCTCAGGAGG + Intronic
980087424 4:128405665-128405687 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
980409663 4:132400321-132400343 GTCTTCTTCCAGTTCTCAGGCGG + Intergenic
980536559 4:134131114-134131136 GTCTTGTGCCAGTTCTCAGGGGG - Intergenic
980569535 4:134596382-134596404 GTCTTGTTCCAGATCTCAGGGGG - Intergenic
980926835 4:139145948-139145970 GTCTTATTCCAGTTCTCAGGGGG - Intronic
981177392 4:141697905-141697927 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
981335734 4:143567203-143567225 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
981522624 4:145679322-145679344 GTCCTTTTCCAGTTCTCAGGAGG + Intergenic
982313074 4:154005396-154005418 TGCTTTTCCAAGTTCTCATGAGG - Intergenic
982520041 4:156405085-156405107 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
982736767 4:159014677-159014699 GGCTTTTCCAATGTGTCAGATGG + Intronic
983001891 4:162425226-162425248 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
983729570 4:170976550-170976572 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
984266332 4:177501501-177501523 GTCTTGTCCCAGTTCTCAGAGGG + Intergenic
985555286 5:555122-555144 GGGGTTTCCGAGGTCGCAGGCGG + Intergenic
985649561 5:1101090-1101112 GGCTGTTCCCAGGTACGAGGCGG - Intronic
985724274 5:1507539-1507561 GGCTTGCTCCAGGTCACAGGTGG + Intronic
986227744 5:5832137-5832159 GTATTATCCCAGTTCTCAGGGGG - Intergenic
986487820 5:8257757-8257779 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
987176504 5:15316177-15316199 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
987440322 5:17947847-17947869 GTCTTCTTCCAGTTCTCAGGGGG + Intergenic
987670058 5:20995034-20995056 GTCTTTTTCCAGTTCTCAAGGGG - Intergenic
988036233 5:25830931-25830953 GTCTTGTACCAGGTCTTAGGGGG + Intergenic
988325796 5:29765770-29765792 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
988561256 5:32283669-32283691 CGCTTTTACCTGGTTTCAGGTGG - Intronic
988876241 5:35449573-35449595 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
988929389 5:36021481-36021503 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
989431323 5:41358785-41358807 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
989607655 5:43260295-43260317 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
990005749 5:50942367-50942389 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
990602436 5:57373216-57373238 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
990891422 5:60654695-60654717 GTCTTTTTCCAGTTCTCAGGGGG + Intronic
991415682 5:66390139-66390161 GTCTTGTTCCAGGTCTCAGGGGG - Intergenic
993448084 5:88039548-88039570 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
993608632 5:90027253-90027275 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
993796952 5:92279497-92279519 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
994347608 5:98705524-98705546 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
994358284 5:98820390-98820412 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
995190069 5:109310347-109310369 GGATTTTAACAGGTCCCAGGCGG + Intergenic
996662375 5:126019726-126019748 GGCTATTCCCAGGACTCACTTGG - Intergenic
996779888 5:127173572-127173594 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
996875069 5:128231671-128231693 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
997763614 5:136475952-136475974 GCCTTGTTCCAGCTCTCAGGTGG + Intergenic
998290840 5:140912673-140912695 GACTTATTCCAGGTCTCAGGGGG + Intronic
998741964 5:145213960-145213982 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
999067330 5:148703205-148703227 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
999256592 5:150213094-150213116 GGGTTTACCCAGGTCCCATGGGG + Intronic
999350746 5:150869052-150869074 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
999839246 5:155406919-155406941 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1001033822 5:168282400-168282422 GGCTCTTCGCTGGTCTTAGGAGG - Intergenic
1001261534 5:170233458-170233480 GGCTCCTCCCAGGTGTCAGTTGG + Exonic
1001564232 5:172689090-172689112 GCTTCTTCCCAGGTCACAGGTGG - Exonic
1001701192 5:173707664-173707686 GGCATTTCCCAGGACTCATCAGG - Intergenic
1001733390 5:173977574-173977596 GTCTTGTTCCAGGTCTTAGGGGG + Intronic
1002202630 5:177538824-177538846 GGCTGTTCCCTGTCCTCAGGTGG - Intronic
1002402804 5:179001239-179001261 TGCCTTTCCCAGGTGTCAGAGGG - Intergenic
1002576192 5:180175466-180175488 GGCTCTTAGCAGGACTCAGGGGG - Intronic
1002582058 5:180215001-180215023 CGCTTTCCCCAGGACCCAGGAGG - Intergenic
1003111170 6:3253224-3253246 GGCTCTTGCTAAGTCTCAGGTGG + Intronic
1004096884 6:12564620-12564642 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1004888871 6:20078487-20078509 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1005925695 6:30443826-30443848 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1005930197 6:30477489-30477511 GACTTGTCCCAGTTCTCAGCGGG - Intergenic
1007526049 6:42494568-42494590 CGCTAGTCCCAGGGCTCAGGAGG - Intergenic
1007837788 6:44688424-44688446 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1009198734 6:60718994-60719016 GGCTTCTCCCATTTTTCAGGGGG + Intergenic
1009867415 6:69414500-69414522 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1010027998 6:71241864-71241886 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1010322683 6:74530959-74530981 GGCTTGCTCCAGGTCTCAAGAGG - Intergenic
1010518052 6:76798902-76798924 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1011156320 6:84337211-84337233 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1011365723 6:86579954-86579976 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1011472011 6:87717462-87717484 GGCAGTTCCCAGCTCCCAGGTGG - Intergenic
1011565882 6:88671026-88671048 GTCTTATTCCAGTTCTCAGGGGG - Intronic
1012003690 6:93685500-93685522 GAGTTTCCCCAGGTCCCAGGTGG - Intergenic
1012302674 6:97608886-97608908 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1012870159 6:104663269-104663291 GGCTTGGTCCAGTTCTCAGGGGG - Intergenic
1013857027 6:114585269-114585291 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1013985225 6:116183968-116183990 GTCTTTTTCCAGTTCTCAGGAGG + Intronic
1014421313 6:121249388-121249410 GTCTTTTTTCAGCTCTCAGGGGG - Intronic
1014532351 6:122573844-122573866 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1014878374 6:126689431-126689453 GTCTTTTTCCAGTTCTAAGGGGG - Intergenic
1015048637 6:128811454-128811476 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1015348179 6:132184183-132184205 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1015643948 6:135365878-135365900 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1015927549 6:138325350-138325372 GGCTTTTCCCAGCTGTCCTGAGG + Intronic
1016176520 6:141083043-141083065 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1018353289 6:162985628-162985650 GTCTTGTTCCAGTTCTCAGGAGG - Intronic
1018656127 6:166038078-166038100 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1018763246 6:166908722-166908744 GGCTTTTCCCAGTCCTCTGAAGG + Intronic
1020455534 7:8369905-8369927 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1020635235 7:10688609-10688631 GTCTTTTTCCAGTTCTCAGAGGG - Intergenic
1021138849 7:16998346-16998368 GTCTTGTCCCAGTTCTCAAGAGG + Intergenic
1021183600 7:17536929-17536951 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1021388044 7:20056460-20056482 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1021746091 7:23742642-23742664 AGCCTTTCCCAGCTCTCAGCTGG + Intronic
1022581982 7:31564624-31564646 GGATTTTCCCAGGTTTCTGCAGG - Intronic
1023519915 7:41039705-41039727 GGCTTGTCCCAAGGCTCAGCAGG - Intergenic
1023923252 7:44646140-44646162 GGCTCTCCCCATGTATCAGGTGG - Intronic
1024926375 7:54619413-54619435 GGCATTTCACAGGTCTCTGAGGG - Intergenic
1024946778 7:54816068-54816090 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1026534648 7:71229747-71229769 GACTTCTCACAGGTCTCAGATGG - Intronic
1027732926 7:81898909-81898931 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1028502202 7:91531561-91531583 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1028996041 7:97101220-97101242 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1030255301 7:107504065-107504087 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1030480642 7:110099504-110099526 GTCTTCTTCCAGTTCTCAGGGGG - Intergenic
1030972643 7:116079252-116079274 GTCTTGTGCCAGTTCTCAGGGGG - Intronic
1031090137 7:117344741-117344763 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1031124311 7:117756315-117756337 GGCATTTCACAGGTCACAGGTGG + Intronic
1031220064 7:118953923-118953945 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1031796560 7:126182594-126182616 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1031850293 7:126854998-126855020 GTCTTGTTCCAGCTCTCAGGGGG + Intronic
1031950259 7:127884669-127884691 GGCTCTTCCCAGGCCTCCTGGGG + Intronic
1032604958 7:133340078-133340100 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1034078574 7:148256295-148256317 GTATTTTCCCATGTCTCTGGGGG - Intronic
1035045049 7:155960116-155960138 GGCCTTTCCCAGACCTCAGCAGG + Intergenic
1035265139 7:157685967-157685989 GGCCTCTCCCAGGTTGCAGGAGG - Intronic
1036502347 8:9325430-9325452 GCATTTTCCCAGCTCTCTGGGGG + Intergenic
1037048681 8:14342150-14342172 GGCTTATTCCAGGTCTCAGATGG + Intronic
1039250750 8:35661435-35661457 GGCATGGCCCTGGTCTCAGGAGG + Intronic
1039436388 8:37562232-37562254 GGGTTTTGCCAGCTCTGAGGGGG - Intergenic
1039815994 8:41094975-41094997 AGCTTCTCCGAGGGCTCAGGGGG - Intergenic
1040576056 8:48652402-48652424 GGCGTTTCCCAGGGAGCAGGGGG + Intergenic
1040670781 8:49687767-49687789 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1040867701 8:52066663-52066685 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1040966936 8:53092168-53092190 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1042208046 8:66348649-66348671 GACTCTTCCCTGGTCTCAGAGGG - Intergenic
1042482606 8:69321240-69321262 GTCTTGTTCCAGCTCTCAGGGGG - Intergenic
1042897162 8:73683532-73683554 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1043537441 8:81221589-81221611 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1043876054 8:85487614-85487636 GTCTTGTTCCAGTTCTCAGGTGG + Intergenic
1044903646 8:96975911-96975933 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1044907573 8:97021295-97021317 GTCTTGTCCCAGTTCTCAGAGGG - Intronic
1045878250 8:107008055-107008077 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
1048371372 8:133780118-133780140 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1048658214 8:136567187-136567209 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1049295662 8:141834637-141834659 GTCTTGTCCCAGTTCTCAGAGGG + Intergenic
1049622191 8:143603540-143603562 GGCTTGTCAGAGGTCCCAGGGGG + Intergenic
1049635708 8:143687741-143687763 TGCTTTTTCCTGGTCTCAGAGGG + Intronic
1050618782 9:7430725-7430747 GTCTTGTTCCAGGTCTCAAGGGG + Intergenic
1051105507 9:13574925-13574947 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1052016067 9:23469414-23469436 GTCTTTTTCCTGGTCTTAGGTGG - Intergenic
1052895565 9:33744663-33744685 GGCTTGTTCCAGTTCTCAGGGGG - Intergenic
1053107230 9:35421069-35421091 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1053522978 9:38800133-38800155 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1054195205 9:62024554-62024576 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1054643203 9:67564135-67564157 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1055244919 9:74228376-74228398 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1055306222 9:74931836-74931858 GCCTTGTTCCAGTTCTCAGGTGG - Intergenic
1056948435 9:91021704-91021726 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1057340121 9:94193032-94193054 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1058104304 9:100952952-100952974 GTCTTGTTCCAGGTCTTAGGAGG + Intergenic
1058160037 9:101559969-101559991 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1059075104 9:111184724-111184746 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1060774239 9:126358859-126358881 GCCTTTTCCCAAATCTTAGGGGG + Intronic
1061281183 9:129598289-129598311 CGCTTGCCCCAGGTCTCAGCTGG + Intergenic
1062308136 9:135921131-135921153 GGCGTTCGCCAGGTCTCGGGTGG - Intergenic
1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG + Intronic
1062419236 9:136471578-136471600 AGCTTTTCACCGGTCTCCGGAGG - Intronic
1202801767 9_KI270720v1_random:6021-6043 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
1186486982 X:9941131-9941153 GGCTTTTCCCTGGAACCAGGAGG + Intronic
1187589182 X:20697224-20697246 GTCTTGTCCCATTTCTCAGGGGG - Intergenic
1187636494 X:21234904-21234926 GTCTTGTCCCAGTTCTCAGAGGG + Intergenic
1187849018 X:23572563-23572585 GTCTTATTCCAGTTCTCAGGGGG - Intergenic
1188040188 X:25362664-25362686 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
1188895037 X:35657078-35657100 GTTTTGTCCCAGTTCTCAGGGGG + Intergenic
1190822307 X:53985196-53985218 AGCTTCTCCCAGCACTCAGGAGG - Exonic
1190895127 X:54610419-54610441 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
1191037791 X:56045914-56045936 GTCTCTTCCCAGTTCTCAGGGGG + Intergenic
1191829646 X:65402369-65402391 GAGTTCTCCCAGGTCCCAGGTGG - Intronic
1192068823 X:67915429-67915451 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
1192164282 X:68816639-68816661 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1192795813 X:74423073-74423095 GACTTCTCCCAGCTCACAGGCGG - Intronic
1192901091 X:75497899-75497921 GTCTTTTTCCAGTTCTCAGGAGG - Intronic
1193015698 X:76731187-76731209 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1193119877 X:77812249-77812271 GCCTTGTTCCAGTTCTCAGGGGG + Intergenic
1193259099 X:79384127-79384149 GTCTTTTCCCAGTTTTCAAGGGG - Intergenic
1193555016 X:82942930-82942952 GTCTTTTCACAGTTCTCAAGAGG + Intergenic
1193775659 X:85638250-85638272 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
1193964227 X:87964671-87964693 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1194038204 X:88907080-88907102 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1194168406 X:90551588-90551610 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1194213987 X:91105949-91105971 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194224618 X:91240914-91240936 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1194278520 X:91917234-91917256 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1194471151 X:94298786-94298808 GTCTTATTCCAGTTCTCAGGGGG + Intergenic
1194510412 X:94787078-94787100 GTCTTGTTCCAGTTCTCAGGCGG - Intergenic
1194583265 X:95702307-95702329 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194606292 X:95982888-95982910 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194770135 X:97893177-97893199 GTCTTTTTCCAGTTCTCAGAGGG + Intergenic
1195063536 X:101219201-101219223 GGCTTCTCCCAGGTCTCTGAGGG + Intergenic
1195818336 X:108913585-108913607 GTCTTTTTCCAGTTCTCATGGGG - Intergenic
1196519036 X:116651021-116651043 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1196994314 X:121364512-121364534 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1197081447 X:122422804-122422826 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1197374993 X:125671951-125671973 GGGTTTACCCAGGACTCAGAAGG + Intergenic
1197471895 X:126873761-126873783 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1197504276 X:127282234-127282256 GTCTTTTTCCAGTTCTCAGAGGG - Intergenic
1197956811 X:131959733-131959755 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1198604175 X:138318495-138318517 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1198950274 X:142061833-142061855 GACTTGTTCCAGGTCTCAGGGGG + Intergenic
1199587175 X:149427505-149427527 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1199853069 X:151739029-151739051 GGGTTTGCCCAGACCTCAGGAGG - Intronic
1200051360 X:153433500-153433522 GGCATTTCCCAGGTCCCCTGGGG - Intergenic
1200333026 X:155318128-155318150 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1200514650 Y:4129375-4129397 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1200561082 Y:4704224-4704246 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1200595853 Y:5139313-5139335 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1200865113 Y:8035132-8035154 GCCTTTTCCCTGTTCTCAGGTGG + Intergenic