ID: 1182451433

View in Genome Browser
Species Human (GRCh38)
Location 22:30424094-30424116
Sequence GGTCTCCGCCGTCACTGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182451433 Original CRISPR GGTCTCCGCCGTCACTGTGA AGG (reversed) Exonic
900125326 1:1066661-1066683 GGCCTCCGCCCTCACAGGGAAGG - Intergenic
900138810 1:1130460-1130482 GGTCTCTGCTGTCACTCTGCTGG + Intergenic
900357820 1:2273226-2273248 GGTCTCCGGCGCCAGTGGGAAGG - Intronic
900955122 1:5882083-5882105 GCTCACAGCCGTCACTGCGAAGG + Intronic
902612076 1:17603281-17603303 GGTCTGTGCAGTCACTGGGAGGG + Intronic
903685445 1:25128378-25128400 AGTCTCCGGCCTCACAGTGATGG - Intergenic
915065709 1:153222485-153222507 TGTCTCAGACCTCACTGTGATGG - Intergenic
915766690 1:158370316-158370338 GGTCTCAGCAGTCACTGTGATGG + Intergenic
921852247 1:219943466-219943488 GGTCTCCTCTGACACTGTGCTGG - Intronic
1063144831 10:3287641-3287663 GGTTTCCGCCGTCACCCTGCTGG + Intergenic
1063432164 10:6000077-6000099 GCTCTCTGCTGTCACTGTGAAGG - Intergenic
1064179089 10:13099887-13099909 GCTCTAAGGCGTCACTGTGACGG - Intronic
1075223446 10:120603847-120603869 GAGCCCTGCCGTCACTGTGACGG + Intergenic
1075726072 10:124611572-124611594 GGGCTCCCCTGTGACTGTGAGGG - Intronic
1077269155 11:1666901-1666923 TGTCTCGGCGGTCACTGTGACGG - Intergenic
1077271392 11:1683813-1683835 TGTCTCGGCGGTCACTGTGACGG + Intergenic
1078328494 11:10399262-10399284 GGTCTCTTCCGTCATTGTCAAGG + Intronic
1094016198 12:25866977-25866999 GGTCTCCACCAACACTGTGTGGG - Intergenic
1102569653 12:113819660-113819682 AGTCACCGCTGTCACTGGGAGGG - Intronic
1107135580 13:36940621-36940643 GGTCTTCACTGTCACTGTGATGG + Intergenic
1107372734 13:39770283-39770305 GGACACCTCCGTCAATGTGAGGG - Intronic
1107712803 13:43167371-43167393 GGTCCCGGCCCTGACTGTGATGG + Intergenic
1107988633 13:45797719-45797741 GGTCACAGACCTCACTGTGAAGG + Intronic
1114557922 14:23572258-23572280 GGTCTCGACTGTCACTGGGAAGG - Intronic
1124190638 15:27573808-27573830 GGTCTCAGCCTTCTCTGGGAGGG + Intergenic
1132335106 15:101043217-101043239 GGTCTCTGGCCTCACTGTGCAGG - Intronic
1141645948 16:85367669-85367691 GGTCCCCGCCTTCATGGTGAGGG - Intergenic
1145005216 17:19333823-19333845 GGACTCGGCCGGCACTGTCACGG + Intronic
1145746117 17:27321109-27321131 GGTCTCCTCCGTTACTCTGGAGG + Intergenic
1150154116 17:62836165-62836187 GGTCTCCACTGACACTGAGATGG - Intergenic
1151605237 17:75131459-75131481 GGTCTCCCCCTTCTCTGTGAAGG - Intronic
1151882185 17:76902606-76902628 CGTCTCCGACATCGCTGTGAAGG + Exonic
1152395471 17:80030365-80030387 GGGCCCCGACGTCCCTGTGAGGG + Intronic
1152544566 17:80994319-80994341 GGTCTTCCCCATCCCTGTGATGG + Intronic
1160842000 19:1150445-1150467 GGTCTCCCCCGTGACTGTGGGGG - Intronic
1160842013 19:1150483-1150505 GGTCTCCCCCGTGACCGTGGGGG - Intronic
1160842026 19:1150521-1150543 GGTCTCCCCCGTGACCGTGGGGG - Intronic
1163393304 19:17043883-17043905 GGTCTCTGCCATCACTGAGCGGG + Intergenic
1163393702 19:17046252-17046274 GGTCTCTGCCATCACTGAGGGGG - Intergenic
1165060990 19:33205130-33205152 GGTCTCTGCTGCCACAGTGATGG + Intronic
924989212 2:297001-297023 AGTCTCCTCCTTCACTTTGAAGG - Intergenic
1174404356 20:50293956-50293978 GGTCTCTGCCCTCACTATGGTGG + Intergenic
1176170948 20:63696156-63696178 GGTCTCCTCCTTCCCGGTGAGGG - Exonic
1176933365 21:14840893-14840915 GGACTCCCCAGTCACTCTGAAGG + Intergenic
1179634055 21:42696272-42696294 TGTCCCCGCCGGCACTGTGTGGG + Intronic
1182451433 22:30424094-30424116 GGTCTCCGCCGTCACTGTGAAGG - Exonic
1183314477 22:37129367-37129389 GGTCTCCGCTTACACTGTGGTGG + Intronic
1184926322 22:47642285-47642307 GGTCTCTGCTGGCACTGTGGTGG - Intergenic
1185170409 22:49290549-49290571 GGGCTCAGCTCTCACTGTGAGGG + Intergenic
959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG + Intronic
960299749 3:115987341-115987363 GGCCTCCAAGGTCACTGTGAAGG - Intronic
968586625 4:1419987-1420009 CGTCTCCGGCGTCACTGGCATGG + Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
977047842 4:92090031-92090053 GGTCTCCACCATCACAGTGGTGG - Intergenic
985961752 5:3307814-3307836 AGTCTCTGCCTTCACTGTCATGG + Intergenic
988610021 5:32714345-32714367 GGCCTCAGCCACCACTGTGAGGG - Intronic
992717936 5:79529986-79530008 GAGCTCCGCCATCACTGGGAAGG + Intergenic
995732986 5:115265423-115265445 GGTCTCAGCCGGCCCTGGGATGG - Intergenic
1001891490 5:175343052-175343074 GGTCTACTCAGTTACTGTGAAGG - Intergenic
1002904803 6:1439556-1439578 GGACTTCGCAGACACTGTGACGG + Intergenic
1006419518 6:33924551-33924573 GGTCTTCGTCGGCACTGGGAGGG - Intergenic
1018434790 6:163750395-163750417 AGTCCCCACCGTCACCGTGAGGG - Intergenic
1018998771 6:168729775-168729797 GGTCTCCCCCGGCTCTGCGATGG - Intergenic
1019610683 7:1935291-1935313 GGTCTCCACTGTGGCTGTGAGGG - Intronic
1026793804 7:73352787-73352809 GTGGTCTGCCGTCACTGTGAGGG + Intronic
1029707408 7:102283099-102283121 GGCCTCCCCCGTGACAGTGACGG + Intronic
1030709956 7:112738549-112738571 GGGCTCCGCCTTCAATGTCAGGG - Intergenic
1040008679 8:42642800-42642822 GGTCGCCCCCTTCACTGAGATGG + Intergenic
1041768701 8:61449204-61449226 GGTCTCCACTGACACTGTGGTGG + Intronic
1042262172 8:66870874-66870896 GGTCACCGCTGTCAGTGGGAGGG + Intronic
1061806824 9:133141477-133141499 GGTCCCCGCAGTTGCTGTGAGGG - Intronic
1061993369 9:134172214-134172236 GGTCACCACAGGCACTGTGAAGG - Intergenic
1200963173 Y:9013481-9013503 GGTCTCCGCCGCCAAGCTGAGGG + Intergenic