ID: 1182451710

View in Genome Browser
Species Human (GRCh38)
Location 22:30425796-30425818
Sequence GGCCGGGCAGACCCAAGTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182451700_1182451710 11 Left 1182451700 22:30425762-30425784 CCTGTCCTTCGGCGCGGGACTTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG 0: 1
1: 0
2: 2
3: 16
4: 163
1182451698_1182451710 16 Left 1182451698 22:30425757-30425779 CCTGACCTGTCCTTCGGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG 0: 1
1: 0
2: 2
3: 16
4: 163
1182451702_1182451710 6 Left 1182451702 22:30425767-30425789 CCTTCGGCGCGGGACTTTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG 0: 1
1: 0
2: 2
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182451710 Original CRISPR GGCCGGGCAGACCCAAGTGC CGG Exonic
901318511 1:8324665-8324687 GGTCGGGCAGGCCCATCTGCAGG - Exonic
901414167 1:9105497-9105519 GGCCGTGCAGACGCCGGTGCTGG - Exonic
902200893 1:14832742-14832764 GGCCAGGCAGAATCAAGTGGCGG - Intronic
902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG + Intronic
902980469 1:20119182-20119204 GGCCCAGCAGACCCTGGTGCTGG + Intronic
905816199 1:40952849-40952871 GGCAGTGGAGAGCCAAGTGCGGG - Intergenic
906204363 1:43979269-43979291 GGCCGGGCAGACCCACGGACCGG - Intronic
906639841 1:47435084-47435106 GGCCAGGCAGAGGCAAGGGCTGG + Intergenic
908682958 1:66682581-66682603 GGCAGGGCACACCTAAGGGCTGG - Intronic
913042568 1:115041478-115041500 GGCAGGGCAGACCCAATTCTTGG + Intergenic
916421555 1:164642226-164642248 GAACGGACAGAACCAAGTGCAGG + Intronic
917923668 1:179771303-179771325 GGCGGGACAGACCCCAGTGCTGG - Intronic
918078487 1:181188616-181188638 GGCAGGGCAGACCCGAATGAGGG - Intergenic
922141571 1:222893562-222893584 GGGCGGGCAGCCCCAGGCGCCGG + Intronic
922714503 1:227859898-227859920 GCCCGGCCAGAGCCGAGTGCTGG - Intergenic
924928371 1:248705474-248705496 GGGTGGGCAGACCCCAGTTCGGG - Intergenic
1062962381 10:1582340-1582362 TGCTGGGCAGACCCCAGTGAGGG - Intronic
1067018145 10:42772744-42772766 GGATGGGCAGTTCCAAGTGCCGG - Intergenic
1067040860 10:42952452-42952474 GGCGGGGCAGGCCCAGCTGCAGG + Intergenic
1067478091 10:46579226-46579248 GGCGGGGCGGAGGCAAGTGCTGG - Intronic
1067616649 10:47762561-47762583 GGCGGGGCGGAGGCAAGTGCTGG + Intergenic
1070820125 10:79349523-79349545 GGCAGAGCAGACCCAAGAGGTGG + Intronic
1073099610 10:100999815-100999837 GGCCGGGCAGCTCCGAGTGGCGG + Exonic
1073436230 10:103517858-103517880 GGCCTGCCAGGCCCAAGTGTTGG - Intronic
1075815784 10:125264060-125264082 GGCAGGGAAGACCCAGGAGCGGG - Intergenic
1076420817 10:130330486-130330508 CGCCCTGCAGACCCAAGTGATGG + Intergenic
1076698105 10:132256794-132256816 GGGCGGGCAGCCCCAGGAGCAGG - Intronic
1077228325 11:1447924-1447946 GGCCGGGCAGGCACATGGGCGGG + Intronic
1077318154 11:1928377-1928399 GGCCAGGCAGACCCCAGAGGTGG + Intronic
1079318407 11:19429650-19429672 GGCTGGGCACTCCCAAGTGCTGG + Intronic
1083849332 11:65355850-65355872 GGCCGAGAAGATCCAGGTGCTGG + Exonic
1084539134 11:69775546-69775568 GGCCGGGCGGAGCCAAGGGTGGG - Intergenic
1084542656 11:69797242-69797264 AGCCGCACAGACCCAAGGGCCGG + Intergenic
1085464570 11:76715161-76715183 AGCCGGGCAGAGCCAAGGGCCGG + Intergenic
1085530396 11:77189174-77189196 GGCAGGGCTGAGCCAAGGGCTGG - Intronic
1085589863 11:77749994-77750016 GGCTTGGCATCCCCAAGTGCTGG + Intronic
1090124774 11:124074757-124074779 GGGTGGGCAGCTCCAAGTGCCGG + Intergenic
1091293043 11:134452807-134452829 TGCCTGGCAGAGCCAAGAGCTGG - Intergenic
1091585490 12:1813796-1813818 GGACGGGGAGACCCATTTGCTGG + Intronic
1096623306 12:52877994-52878016 GGCCCGGCAGACCCAGGTGCTGG + Intergenic
1097129837 12:56803960-56803982 GGCCGGGCAGCTCCAGGTGCTGG + Intergenic
1103919581 12:124392555-124392577 AGCCGGGCAGACCCAAACCCAGG + Intronic
1103944260 12:124517550-124517572 GGCAGGGGAGAGCCAGGTGCAGG - Intronic
1106432414 13:29693783-29693805 GGCAGGGTGGAGCCAAGTGCAGG + Intergenic
1108240212 13:48456760-48456782 GGGCGGGCAGCTCCAGGTGCTGG + Intronic
1109780880 13:67108018-67108040 GGACGGGCAGCTCCAGGTGCTGG - Intronic
1111304102 13:86383250-86383272 GGATGGGCAGCTCCAAGTGCTGG - Intergenic
1112398505 13:99055430-99055452 GGCTGGGCAGCCTCCAGTGCGGG + Intronic
1112508845 13:99991183-99991205 GGCTTGGGAGACCCAACTGCAGG - Intergenic
1113424676 13:110198394-110198416 TGCCGGGCAGACCCAGGTTGGGG - Intronic
1113931853 13:113972883-113972905 AGCCGGGCACAGCCAAGGGCGGG - Intergenic
1113938051 13:114005588-114005610 GGAAGGCCAGCCCCAAGTGCGGG + Intronic
1118854761 14:69612054-69612076 GGCCGCGCAGCCCCCACTGCTGG - Intronic
1122587619 14:102820263-102820285 GGGCAGCCAGACCCAAGGGCAGG - Intronic
1122651704 14:103230121-103230143 GGCCGGGCGGCCTCATGTGCAGG + Intergenic
1122893680 14:104744773-104744795 GGCCGGGCAAACCCAAGAAGTGG - Intronic
1123017305 14:105381574-105381596 AGCTGGGCAGAGCCAGGTGCAGG - Intronic
1202902345 14_GL000194v1_random:51026-51048 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1125510587 15:40290530-40290552 GGCTGGGCAGACCCCACTTCAGG - Intronic
1127931800 15:63601631-63601653 GGGCGGGCAGACGCGCGTGCGGG - Exonic
1129612349 15:77070861-77070883 GGCCGGGCAGAGCGAGGGGCCGG - Intronic
1129723836 15:77891722-77891744 GGCTGGGCAGCACCAAGTGAGGG + Intergenic
1132599004 16:765633-765655 GGCCGGGCATCCCCACGGGCTGG - Intronic
1132693199 16:1190804-1190826 GGCCCTGCAGACCCAAGAGCTGG + Intronic
1133042311 16:3067124-3067146 AGCTGGGCAGGCCCAAGAGCAGG - Intronic
1134309238 16:13060795-13060817 GGTAGGGCAGAGCCAAGGGCTGG + Intronic
1134309636 16:13063928-13063950 GGTAGGGCAGAGCCAAGGGCTGG - Intronic
1134671178 16:16056267-16056289 GGGCGTGCAGACCCAGGTGAAGG - Exonic
1134819341 16:17233549-17233571 GGCTGGGCAGGCCCAGGAGCTGG - Intronic
1136024523 16:27461247-27461269 GGCTCGGCAGACCCAAGGCCAGG + Exonic
1136705136 16:32181289-32181311 GGATGGCCAGAGCCAAGTGCTGG + Intergenic
1136762776 16:32748117-32748139 GGATGGCCAGAGCCAAGTGCTGG - Intergenic
1136805324 16:33122269-33122291 GGATGGCCAGAGCCAAGTGCTGG + Intergenic
1137588760 16:49680665-49680687 GGGCGGGCAGCTCCATGTGCTGG - Intronic
1139375248 16:66492874-66492896 GGCCAGGCAGGACCAAGGGCTGG - Intronic
1139481725 16:67234389-67234411 GGCCGGGCAGAGACACTTGCCGG - Exonic
1203064932 16_KI270728v1_random:1008436-1008458 GGATGGCCAGAGCCAAGTGCTGG - Intergenic
1149020844 17:51962379-51962401 GACCGGGCAGGCCCATGTACAGG - Intronic
1150477679 17:65487350-65487372 GGCCGGGAAGACCAAAGTCACGG + Intergenic
1150958963 17:69893617-69893639 AGCTGGGCAGTCCCAAGTCCAGG + Intergenic
1151469642 17:74309984-74310006 GGCCGGGCAGACCCAGGTAGAGG - Intronic
1152151416 17:78603630-78603652 GGACTCGCAGACCCAGGTGCTGG - Intergenic
1152514658 17:80816314-80816336 GGCCTGGCTGGCCCCAGTGCAGG + Intronic
1155077847 18:22377812-22377834 AGCCTGGCAGTACCAAGTGCCGG + Intergenic
1156337935 18:36186819-36186841 GCCCGGCCACACCCACGTGCGGG + Intergenic
1159182581 18:64927863-64927885 GTCCGGGCAAACCACAGTGCAGG - Intergenic
1162372678 19:10288760-10288782 GGCCGGGGAGAGCCACGGGCAGG + Intergenic
1162647166 19:12058270-12058292 GCCTGGGCAGCCCAAAGTGCTGG + Intergenic
1163321494 19:16577380-16577402 GGCTGGGCAGCCGCAAGCGCCGG - Exonic
1164239600 19:23372917-23372939 TGCAGGGCAGACCCAAGGGCAGG - Intronic
1164253264 19:23503501-23503523 TGCAGGGCAAACCCAAGGGCAGG - Intergenic
1164297157 19:23922203-23922225 TGAAGGGCAGACCCAAGGGCAGG + Intronic
1164317648 19:24107997-24108019 TGCAGGGCAGACCCAAGGGCAGG + Intronic
1165104642 19:33461785-33461807 GACCACGCAGACGCAAGTGCTGG + Intronic
1165942244 19:39420789-39420811 GGTCGAGGAGACCCAAGTGGGGG - Exonic
1166130650 19:40743855-40743877 GGCCGGGGAGACCCAGGTTGAGG + Intronic
1166872998 19:45882280-45882302 AGCTCTGCAGACCCAAGTGCCGG - Intergenic
1168655670 19:58125807-58125829 GGCCTGGCTGACCCCAGTCCTGG + Intergenic
925754274 2:7118942-7118964 GGCAGGGCAGACCCATGACCAGG + Intergenic
925836012 2:7947688-7947710 GGCTGGGCAGACACACGTGCTGG - Intergenic
925893914 2:8457090-8457112 GGCCGGGCAGGTGCAGGTGCGGG - Intergenic
926133284 2:10318904-10318926 GTCCCGGCAGACCCAAGGGCTGG - Intronic
926167370 2:10529868-10529890 GGCAGCTCAGCCCCAAGTGCAGG - Intergenic
929465150 2:42137482-42137504 GGCAGGGCTGATCCAGGTGCAGG + Intergenic
929653510 2:43706005-43706027 GGCTGGGCAGAACTAAGTACAGG - Intronic
934504325 2:94879378-94879400 GGCCCAGCAGCCCCAGGTGCTGG - Intergenic
936239384 2:110773784-110773806 GGCTGGCCTGACCAAAGTGCTGG - Intronic
936383910 2:112011987-112012009 GGCCAGGCAGAGCCCAGTGGGGG + Intronic
937894904 2:126971366-126971388 GGCCAGGCCGACCCAAGGGCAGG - Intergenic
943756590 2:191563587-191563609 GGCTGGGAAGAGCCAAGTCCAGG - Intergenic
946339985 2:219060615-219060637 GGCCGGCGGGACTCAAGTGCGGG + Intergenic
946431039 2:219627607-219627629 GGCCGGGCGGACGCAGGCGCCGG - Exonic
1173645419 20:44630090-44630112 GGCCTGGGAGGCCAAAGTGCTGG - Intronic
1175237489 20:57524924-57524946 GGCCGGAAAGGCCCAAGGGCGGG - Intronic
1176621713 21:9065793-9065815 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1179479601 21:41668979-41669001 GCCCCGGAAGTCCCAAGTGCTGG - Intergenic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1179980348 21:44892204-44892226 GGCCGGGGAGATCCTGGTGCCGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182146050 22:27997431-27997453 TGCCTGGCAGCCCCAGGTGCTGG - Intronic
1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG + Exonic
1183379061 22:37481701-37481723 GGCCGGGCAGTCCCAGGGCCGGG - Intronic
1185271207 22:49929922-49929944 GGCCCTGCAGACCCCAGTCCTGG - Intergenic
950994596 3:17481209-17481231 GGGCGGGCAGCCCTAGGTGCCGG - Intronic
951806419 3:26649192-26649214 GGCCAGGCTGTCCCAAGTACAGG + Intronic
954737183 3:52716057-52716079 GGGCGGGCAGCTCCAGGTGCCGG - Intronic
957418004 3:79930283-79930305 GGGCGGGCAGTTCCAGGTGCTGG - Intergenic
957845064 3:85721573-85721595 GGGCGGGCAGCTCCAGGTGCCGG + Intronic
958462556 3:94418135-94418157 GGGCGGGCAGAGACAAGTCCTGG - Intergenic
959037581 3:101384568-101384590 GGACGGGCAGCTCCAGGTGCTGG - Intronic
962105053 3:132381608-132381630 GGGCGGGCAGCTCCAGGTGCCGG + Intergenic
964129231 3:153268768-153268790 GGCCGCGCAGTTCCAAGTGCGGG - Intergenic
966854750 3:184186302-184186324 GGCTGGGGAGACCGAAGTGGAGG + Intronic
968464385 4:743193-743215 GGCCTGGGAAACCCAGGTGCGGG - Intronic
968498567 4:932483-932505 GGCCGGGCTGACTCAAGCGGAGG + Exonic
968901145 4:3432536-3432558 GGCCAGACAGACCCACGTGGGGG + Intronic
969576871 4:8041226-8041248 ATCGGGGCAGACCCAAGTGGGGG - Intronic
972604806 4:40604203-40604225 GACCTGGCAGAGCCAAGTTCTGG + Intronic
973771131 4:54207849-54207871 GCCCGGGCCGCCCAAAGTGCTGG - Intronic
977020253 4:91749802-91749824 GGCAGGGCAGACTCAACTGGGGG + Intergenic
977908292 4:102501663-102501685 GCCCGGGCGGGCCCGAGTGCGGG - Exonic
979649812 4:123115590-123115612 GGCCGGGCTGACCTACCTGCAGG - Intronic
980053684 4:128061142-128061164 GGCGGGGCAGACCCTCGGGCCGG + Intergenic
985556385 5:560402-560424 TGCCGGGCAGACCCCAGCGTGGG - Intergenic
993236058 5:85311725-85311747 GGACGGGCAGCTCCAGGTGCTGG - Intergenic
996978382 5:129461074-129461096 GGCGGGGCAGACAGAAGTGCGGG - Intronic
1004196601 6:13511307-13511329 GGGCGGGCCGCTCCAAGTGCGGG + Intergenic
1005083505 6:21980835-21980857 GAGCAGGCAGACCCCAGTGCAGG - Intergenic
1006622724 6:35377695-35377717 GGCCTGGCAGCCTCAACTGCTGG - Intronic
1007650083 6:43413842-43413864 GGGCAGGCAGCTCCAAGTGCTGG - Intergenic
1013141364 6:107338971-107338993 GGCCTGGCATCCCTAAGTGCTGG + Intronic
1017824541 6:158071722-158071744 GGCCGGGCAGTCCCAGGTGAAGG + Exonic
1026904997 7:74057751-74057773 GGGCGGTCAGACCCCAGAGCAGG - Intronic
1029739137 7:102482168-102482190 AGCCGGTCAGCCCCAAGAGCGGG + Intergenic
1029757138 7:102581347-102581369 AGCCGGTCAGCCCCAAGAGCGGG + Exonic
1029775078 7:102680408-102680430 AGCCGGTCAGCCCCAAGAGCGGG + Intergenic
1030903369 7:115151431-115151453 GGCTGGGCAGATCCAAGAGATGG - Intergenic
1035181764 7:157094491-157094513 GGCCGGACAAACCCAAGAGGCGG - Intergenic
1040549574 8:48427889-48427911 AACAGGGCAGACCCAAGTGCTGG - Intergenic
1041381579 8:57258712-57258734 GGAAGAGCAGACCCTAGTGCGGG + Intergenic
1049394236 8:142391708-142391730 GGGCGGGCAGCCCTAGGTGCTGG - Intronic
1049707415 8:144049320-144049342 GGCCGGGCAGCGCCAGGGGCGGG - Intergenic
1052652276 9:31320712-31320734 GGGCGGGCAGTTCCAGGTGCCGG + Intergenic
1056658705 9:88529247-88529269 GGCCGGAGAGACCCCAGTGAAGG - Intergenic
1057217595 9:93238049-93238071 GACAGGGCAGAGCCAAATGCGGG - Intronic
1058829515 9:108802949-108802971 GCCAGTGCAGACCCAGGTGCAGG + Intergenic
1059331977 9:113541422-113541444 GGCTGAGCAAACCCAAGGGCGGG + Intronic
1060481386 9:124018451-124018473 GGCCGGCCAGAGGCAAGGGCAGG - Intronic
1060968558 9:127724924-127724946 GGCGGGGCAGGCCCGAGGGCAGG + Intronic
1061346208 9:130027672-130027694 GGCTGGGGGGACCCAACTGCTGG + Intronic
1062497744 9:136839599-136839621 GGCCGGCAAGGCCCAAGTGTGGG - Intronic
1203744898 Un_GL000218v1:36203-36225 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1203565207 Un_KI270744v1:83281-83303 GGCCCAGCAGCCCCAGGTGCTGG - Intergenic
1185602884 X:1352254-1352276 GGCCGGGCTGTCCCTGGTGCGGG + Intronic
1186805956 X:13140180-13140202 GGGCGGGCAGCTCCAGGTGCTGG - Intergenic
1192251642 X:69418530-69418552 GACCAAGCAGACCCCAGTGCTGG - Intergenic
1192632879 X:72790683-72790705 GGCCAGGCAGACTCGAGTCCTGG - Intronic
1192648830 X:72930118-72930140 GGCCAGGCAGACTCGAGTCCTGG + Intronic
1193467492 X:81867053-81867075 GGGTGGGCAGCCCCAGGTGCTGG + Intergenic
1195470012 X:105220179-105220201 GGCCAGGCTGCCCCAGGTGCAGG + Exonic
1195732660 X:107981909-107981931 GGCCAGGCTGCCCCAGGTGCAGG + Exonic
1201158234 Y:11151246-11151268 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic