ID: 1182457580

View in Genome Browser
Species Human (GRCh38)
Location 22:30461713-30461735
Sequence ATGGGCTTGCTTCCGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182457572_1182457580 11 Left 1182457572 22:30461679-30461701 CCCCGCCATAGTTAATCTGCGGA 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1182457574_1182457580 9 Left 1182457574 22:30461681-30461703 CCGCCATAGTTAATCTGCGGACA 0: 1
1: 0
2: 1
3: 1
4: 46
Right 1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1182457573_1182457580 10 Left 1182457573 22:30461680-30461702 CCCGCCATAGTTAATCTGCGGAC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1182457575_1182457580 6 Left 1182457575 22:30461684-30461706 CCATAGTTAATCTGCGGACATGG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182457580 Original CRISPR ATGGGCTTGCTTCCGTCTCC TGG Intronic
901661619 1:10801652-10801674 ATGTGCTGGGTTCCTTCTCCTGG + Intergenic
903163211 1:21503786-21503808 CTTGGCTTGCTGCCTTCTCCAGG + Intergenic
903764822 1:25727497-25727519 ATGGCCTTGCCCCCGACTCCAGG + Intronic
906177405 1:43786483-43786505 CTTAGCTTGCTTCTGTCTCCAGG + Intronic
911004323 1:93202368-93202390 AGGGGCTTGCTTCTGCCTCTCGG + Intronic
916014853 1:160741033-160741055 TTGGGGTTTCTTCCCTCTCCAGG + Intronic
918003452 1:180520103-180520125 CTGGGCTAGCTCCCATCTCCAGG - Intergenic
918294276 1:183141208-183141230 ATGCACCTGCTTCAGTCTCCCGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063177918 10:3568890-3568912 ATGGGCATGCTTGCGTTTCTAGG - Intergenic
1064873010 10:19961180-19961202 ATGGGGTTACATCCATCTCCAGG - Intronic
1066210044 10:33227583-33227605 TTGGGCTTGCAACCTTCTCCTGG + Intronic
1067196398 10:44123254-44123276 GTGGGCCTGCCTCCCTCTCCAGG - Intergenic
1070797391 10:79224602-79224624 AAGGGCCTGCTTCTGTCACCAGG + Intronic
1075054241 10:119206474-119206496 ATGGGCTGTCTTCGGTCACCCGG - Intergenic
1075574503 10:123569023-123569045 AGGGGGTTGCTTCGGGCTCCAGG + Intergenic
1076143696 10:128099636-128099658 TTGGGCATGCTTCTGTCTACAGG - Intronic
1078132003 11:8620919-8620941 ATGGGCTTACTCCCCTCTTCTGG - Intronic
1081999028 11:47382857-47382879 ATGGGATATCTTCCTTCTCCTGG - Intergenic
1083065556 11:59920216-59920238 ATGGACTTTCTTCCTTCCCCCGG + Intergenic
1083703274 11:64495365-64495387 AGGGGCATGTTTCCCTCTCCAGG + Intergenic
1085054406 11:73395387-73395409 AGGGGCTGGCTTCTGGCTCCAGG - Intronic
1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG + Intronic
1088618692 11:111660196-111660218 ATGGGCCTGATTTCGTCTCAGGG - Intronic
1090639562 11:128718591-128718613 ATGGTCTTGCTGTTGTCTCCAGG - Intronic
1093845868 12:23970862-23970884 ATGGGCTTGATTCTAACTCCTGG + Intergenic
1100223156 12:92528492-92528514 ATGGGCTTCCCTGGGTCTCCAGG + Intergenic
1104994104 12:132643330-132643352 ACGGTCTTGTTTCCTTCTCCAGG - Exonic
1105017714 12:132796220-132796242 GTGGGCTTCATTCCTTCTCCAGG - Exonic
1105072332 12:133242300-133242322 ATCGGCTTGCTGCCTTCTCATGG - Intergenic
1105884957 13:24633892-24633914 TTGGGCTTGCTTCCTCCTCAAGG - Intergenic
1118130999 14:62963468-62963490 ATCGGCTTTCTTGGGTCTCCTGG - Intronic
1118636100 14:67750261-67750283 ATGGGCATTTTTCAGTCTCCAGG - Intronic
1118823900 14:69363230-69363252 ATGGCCTTGCTGCCATCACCAGG + Intergenic
1121100249 14:91245362-91245384 CTGGGCTTGATTCCTTCTCTGGG - Intronic
1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG + Intergenic
1122816926 14:104318603-104318625 ATGAGCTTCCTCCCGTCTCGAGG + Intergenic
1133637335 16:7680489-7680511 ACTGTCTTGCTTCCGTCTCTAGG - Intronic
1137233612 16:46593660-46593682 ATGGCATAGCTTCAGTCTCCTGG - Intronic
1137309534 16:47240630-47240652 TTTGGCTTGCTTCCGCCTCTTGG - Intronic
1140170513 16:72599303-72599325 ATGGGCTTTCATCCCTCTCAAGG + Intergenic
1141120125 16:81347393-81347415 ATGGACTGGCTTCCTTCTGCTGG + Intronic
1152307087 17:79527474-79527496 ATGGGCTTTGTGCCCTCTCCTGG + Intergenic
1161225982 19:3146177-3146199 ATGGGACTGCTTCTGCCTCCAGG - Intronic
1167704355 19:51070164-51070186 CTGGGCATGCTTCCATCTCAGGG + Intergenic
928622800 2:33108203-33108225 GTGGCCTTGCTTCTGTCTCTGGG + Intronic
938579037 2:132629764-132629786 CTAGGCTTGCTTCCCTCTCTGGG + Intronic
943664216 2:190591715-190591737 GTGGGCTTTCTTTAGTCTCCAGG - Intergenic
945701984 2:213182598-213182620 ATGGGCTTATTTCCATTTCCTGG - Intergenic
1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG + Intergenic
1171197733 20:23214277-23214299 ATGGCCGTGCTTGCATCTCCAGG - Intergenic
1175109528 20:56637327-56637349 AGGGGGATGCTTCCTTCTCCCGG + Intronic
1175653550 20:60749685-60749707 ATGGCCTTGCTCCAGCCTCCAGG - Intergenic
1180736449 22:18021418-18021440 ATGGGCATGCTTCACTCTCTTGG - Intronic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182511717 22:30824784-30824806 ATGGGCTTGCTGCCTGCTCCGGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
953982479 3:47419611-47419633 ATGGGCTCTGTTCCGTCACCTGG + Exonic
956692915 3:71894162-71894184 ATGGGCTTCCTTCCTTTTCTGGG + Intergenic
962146229 3:132842820-132842842 ATGGGCTTACTTGAGTCTACTGG + Intergenic
968149724 3:196327536-196327558 ACGGACTTGCTCCCGTATCCTGG - Exonic
971058658 4:22941995-22942017 ATGGGCTTTCTTCCTTCGCTGGG - Intergenic
972344420 4:38180929-38180951 ATGGGTTTGCTTACTTCTCCAGG - Intergenic
979162408 4:117480000-117480022 ATTGGCTTTCCTCCGTCTCCAGG - Intergenic
982315449 4:154026232-154026254 ATGGGATTGTTTCCTTCTCGTGG - Intergenic
986489126 5:8271392-8271414 AACAGCTTGCTTCCATCTCCTGG - Intergenic
988117867 5:26920126-26920148 GTGGGCTTCCTTCTGTCCCCAGG - Intronic
997368457 5:133340606-133340628 ATGGCCTTCCTGCCTTCTCCTGG - Intronic
998655131 5:144170458-144170480 ATGGGCTTGTTGCCGTCTTTCGG - Intronic
999147740 5:149407019-149407041 ACAGGCTGGCTCCCGTCTCCAGG + Intergenic
1001799983 5:174534658-174534680 ACGGGATTCCTTCCGTATCCTGG + Intergenic
1007224198 6:40301579-40301601 ATGTGTTTGTTTCCCTCTCCTGG + Intergenic
1014222862 6:118815845-118815867 ATTGGGTTGCTTCCATCACCAGG - Exonic
1016920473 6:149288373-149288395 GTCTGCTTGCTGCCGTCTCCTGG - Intronic
1022132760 7:27419083-27419105 GAGGGCTTGCTTACGGCTCCTGG - Intergenic
1027385563 7:77656257-77656279 AGGGGCTGGCTTCCGGATCCTGG + Intergenic
1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG + Intergenic
1034896197 7:154877947-154877969 CTGGGCCGGCTTCCGTGTCCTGG - Intronic
1035033782 7:155882135-155882157 ATGGGCTCCCTCCAGTCTCCTGG + Intergenic
1035492926 7:159295741-159295763 ATCGGCTTGCTGCCTTCTCATGG - Intergenic
1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG + Intergenic
1038315379 8:26480250-26480272 CTGGGCCTGCTTCATTCTCCTGG - Intronic
1042516870 8:69668554-69668576 TTGGGCTTGCCTCCTGCTCCTGG + Exonic
1042531158 8:69817398-69817420 CTTGGCTTGCTTCCGCCTCTTGG + Intronic
1049290212 8:141797786-141797808 GTGAGCTTGCATCTGTCTCCAGG + Intergenic
1050237571 9:3597840-3597862 ATGGGGTGGCTTCCCTCTGCTGG - Intergenic
1054540849 9:66266364-66266386 ATGGGCTTTCTGCCGGCTTCTGG + Intergenic
1054781213 9:69167624-69167646 ATCTGCTTGCTTCAGCCTCCTGG - Intronic
1055575165 9:77653904-77653926 ATGGGATTGCTTCAGTCTTTTGG - Intergenic
1056791143 9:89626082-89626104 ATGGGTTTTCTCCCTTCTCCAGG + Intergenic
1059246764 9:112855834-112855856 AGGGGCTGGCTGCCTTCTCCTGG + Intronic
1189812728 X:44795701-44795723 ATGTCCTTGCTTGCGTCTACTGG - Intergenic
1195585146 X:106556567-106556589 ATGGGCTTGCTGCTGTCATCAGG + Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1201900496 Y:19042980-19043002 TTGGGCGTGTTTGCGTCTCCGGG + Intergenic