ID: 1182458741

View in Genome Browser
Species Human (GRCh38)
Location 22:30469669-30469691
Sequence CTGTTTGGGCCCCCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182458741_1182458751 15 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458751 22:30469707-30469729 CCAGCCCTACCTTGGGCTATGGG 0: 1
1: 0
2: 0
3: 12
4: 120
1182458741_1182458755 23 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458755 22:30469715-30469737 ACCTTGGGCTATGGGACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 180
1182458741_1182458746 7 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458746 22:30469699-30469721 CATAAATCCCAGCCCTACCTTGG 0: 1
1: 0
2: 0
3: 7
4: 144
1182458741_1182458749 14 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458749 22:30469706-30469728 CCCAGCCCTACCTTGGGCTATGG No data
1182458741_1182458747 8 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458747 22:30469700-30469722 ATAAATCCCAGCCCTACCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 128
1182458741_1182458754 22 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1182458754 22:30469714-30469736 TACCTTGGGCTATGGGACTGTGG 0: 1
1: 0
2: 2
3: 18
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182458741 Original CRISPR CTGTTTGGGCCCCCAAACCC AGG (reversed) Intronic
900502138 1:3011605-3011627 CTGGTTGGGCCCCAAAATACTGG - Intergenic
901771399 1:11532059-11532081 CAGGTTGGGGCCCCAGACCCTGG + Intronic
902917236 1:19646050-19646072 CTGTGCCAGCCCCCAAACCCAGG - Intronic
904346682 1:29876957-29876979 CTTTTTGGGCTCCCGCACCCAGG - Intergenic
906237786 1:44222225-44222247 CTGTTTGAGCACACAAGCCCAGG - Intronic
906754155 1:48292881-48292903 CTCTGTGGGCACCCAAACCCTGG - Intergenic
909866185 1:80674892-80674914 CTATTTGGGACACCAAAACCTGG - Intergenic
910232391 1:84999153-84999175 CTGCAGGGGTCCCCAAACCCCGG - Intronic
910484760 1:87700946-87700968 GTGTTGGAGCCCCCAACCCCTGG - Intergenic
910703454 1:90101787-90101809 CTGTTTTGGTCTCCAAAGCCAGG - Intergenic
912433785 1:109644126-109644148 CTGCTTGTCCCCCCAACCCCAGG + Intergenic
912963831 1:114219617-114219639 CTGTTTGGAATGCCAAACCCTGG - Intergenic
918304202 1:183231029-183231051 CAGTTGGGGCCACCAAATCCTGG - Exonic
1066049106 10:31618808-31618830 CTGTCTGAACCCCAAAACCCAGG - Intergenic
1067451415 10:46384313-46384335 CTGTTGGGACTCCCAAACCAAGG - Intronic
1067585827 10:47475443-47475465 CTGTTGGGACTCCCAAACCAAGG + Intronic
1071794354 10:88989641-88989663 CTGTTTGGGCCCTCAAATCTAGG - Intronic
1073445975 10:103580490-103580512 GTGTTTGGGGCCCCAAGCCATGG - Intronic
1077113625 11:873025-873047 CTGTCAGGGACCCCAACCCCAGG + Intronic
1077307694 11:1875336-1875358 CTGTTAGGATCCCCACACCCAGG - Intronic
1078872698 11:15363710-15363732 CTGATTAGGTCCCCAAACTCAGG - Intergenic
1079135621 11:17774674-17774696 CTGTCTGGGCCCCTGAAACCTGG - Intronic
1080210658 11:29781317-29781339 CAGTTTGGGCCCCCTAAGCATGG + Intergenic
1082795296 11:57374631-57374653 CTGTGTGGGGCCCTAATCCCAGG + Intergenic
1083805885 11:65073672-65073694 CTGTTTGCACCCCAGAACCCTGG - Intronic
1084088127 11:66864112-66864134 CTGTTTCTGCCACCAAACCCAGG + Intronic
1084476365 11:69391796-69391818 CTTTGTGGGCCCCCCGACCCCGG - Intergenic
1089640693 11:119845426-119845448 CTGCATGGGCCCCCCAACCCAGG - Intergenic
1091220229 11:133926286-133926308 TTGTGTTGACCCCCAAACCCCGG - Intronic
1095991440 12:48037290-48037312 CTCTTTGGGCTTCAAAACCCTGG - Intergenic
1097747481 12:63316628-63316650 CTGTTTTGACCCTCAGACCCTGG - Intergenic
1098913269 12:76232089-76232111 ATGCTTGGGCCCTCAAACCCAGG - Intergenic
1101867160 12:108528681-108528703 CTGTTTGGTCTCCCACACCCGGG - Intronic
1107490592 13:40877209-40877231 CTGCTAAGGCCCTCAAACCCGGG + Intergenic
1112273867 13:97997388-97997410 TTGTCTGTGCCCCCAAAACCTGG - Intronic
1116935763 14:50738467-50738489 CTGGTTGGGTCTGCAAACCCAGG + Intronic
1119278223 14:73380101-73380123 CTGTTTGCGCCCCCAGCTCCAGG + Intronic
1120787575 14:88551281-88551303 CTGTTTGGGCGTCCCCACCCTGG - Intronic
1122791245 14:104185098-104185120 CAGTCTCGGCCCCCACACCCTGG + Intergenic
1124219288 15:27835415-27835437 CTCTTTGGGCCCCCACAACCTGG + Intronic
1124649614 15:31465171-31465193 CTGTAGGAGCCCCCAGACCCAGG + Intergenic
1124845957 15:33290289-33290311 TAGCCTGGGCCCCCAAACCCAGG + Intergenic
1125956950 15:43797099-43797121 CTTTTAAGGCCCCCAAAACCTGG + Exonic
1130747748 15:86674320-86674342 CTGTTTGGGCCTCCTCATCCTGG + Exonic
1131829024 15:96342635-96342657 CTGTAAATGCCCCCAAACCCGGG + Intergenic
1132353105 15:101152809-101152831 CTGTTTTTGCTCACAAACCCAGG + Intergenic
1132500780 16:283706-283728 CTCCATGGGCCCCCAAAGCCTGG - Intronic
1137453600 16:48600186-48600208 CTGTTTGGGCCCATCTACCCTGG + Intronic
1137480775 16:48850221-48850243 CTGTTTCTGCATCCAAACCCAGG + Intergenic
1138247898 16:55480507-55480529 CTGGCTGGGCTCCCAAACCGCGG + Intronic
1138423494 16:56915067-56915089 GTGTTTGAGCCCCCAAAGCTAGG + Exonic
1139383497 16:66549505-66549527 CTGTGTGGGTCCCCACTCCCAGG + Intronic
1143106889 17:4534559-4534581 ATGCTGGGGCACCCAAACCCGGG - Intronic
1147791029 17:43014351-43014373 CTATATGGGCACCCAAGCCCAGG - Exonic
1147982376 17:44282510-44282532 CTCTCTGGGCCCCAAACCCCTGG + Intergenic
1149037509 17:52151895-52151917 CTATCTGGGCTCCAAAACCCAGG + Intronic
1149072423 17:52558423-52558445 ATATTTGAGCCCCCAAATCCAGG + Intergenic
1151477218 17:74350910-74350932 CTCCTTGTCCCCCCAAACCCTGG - Intronic
1160494425 18:79363821-79363843 CTGTTTACGCCTCCCAACCCAGG - Intronic
1160580691 18:79883224-79883246 CAGTCTTGGCCCCCAACCCCTGG - Intronic
1161126391 19:2560396-2560418 CTGCTTGGGCCCCCTAAAGCAGG - Intronic
1161390749 19:4019158-4019180 CTGTTTGGGGCCAGAAACCCAGG - Intronic
1161493311 19:4574730-4574752 CTGCCTGGGCTCCCACACCCTGG - Intergenic
1164732641 19:30517891-30517913 CTGTTTGCACCCCCAAATCATGG - Intronic
1165117669 19:33538693-33538715 ATGTTTGAGGCCCCACACCCAGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
925293271 2:2762435-2762457 CTGACAGGGCCCTCAAACCCCGG - Intergenic
926830537 2:16957500-16957522 CTGTATGGGGCCCCAGATCCTGG - Intergenic
927186463 2:20485845-20485867 CTGTATGACCCCCCAACCCCAGG - Intergenic
927937392 2:27083417-27083439 CGGCTTGGGCCCCCAACACCTGG - Exonic
932422383 2:71608786-71608808 CTCTCTAGGCCCCCAAACGCTGG - Intronic
934779672 2:96961644-96961666 CTGTTTGGGACAGCAAACCCAGG + Intronic
937383211 2:121400609-121400631 CTGTTTGGGAACGCAAATCCAGG - Intronic
938579909 2:132636381-132636403 CTGAGTGGGCTCCCAGACCCTGG - Intronic
943254718 2:185579854-185579876 CTGTTGGGGCCCTGAACCCCAGG - Intergenic
943645615 2:190406263-190406285 CTGTTTGGGACCCCAGAGTCTGG + Intergenic
945994467 2:216424454-216424476 CTGTTGGGCCTCCCAAACCAAGG + Intronic
946228694 2:218278632-218278654 CTATTTGGGCCCCAAATCACTGG - Intronic
947749613 2:232525510-232525532 ATGTCTGGGCCCCCAGCCCCTGG + Exonic
1170853058 20:20021237-20021259 ATCTTGGGGACCCCAAACCCTGG - Intronic
1173020851 20:39267011-39267033 CTGCTGGGTCCCCCAAACACAGG + Intergenic
1173928339 20:46797742-46797764 CTGTATTCGCCCCCAAACCTAGG + Intergenic
1174131825 20:48350257-48350279 GTGTTTGTGCTTCCAAACCCAGG - Intergenic
1176000300 20:62828642-62828664 CTGTGTCTGCCCCCACACCCTGG - Intronic
1178495854 21:33085756-33085778 CTGTTTCCTCCCCCCAACCCTGG + Intergenic
1180975623 22:19846443-19846465 CAGTATGGGCCCCAGAACCCAGG + Exonic
1181266618 22:21634450-21634472 CTGTCTGGGCTCCCACAGCCGGG + Exonic
1181456484 22:23062939-23062961 CTGTTTGCTGCCCTAAACCCAGG - Intronic
1181716884 22:24737639-24737661 CTTTTGGGGTCCCCAATCCCAGG + Intronic
1182458741 22:30469669-30469691 CTGTTTGGGCCCCCAAACCCAGG - Intronic
1183986868 22:41574921-41574943 CTGTGTGGCTCCCCAACCCCCGG - Exonic
1184038156 22:41928304-41928326 CAGTTGGGGACCCCAAACACTGG - Intergenic
1185151303 22:49165109-49165131 CTGGGTGGGCTCCCAAAGCCTGG - Intergenic
1185287281 22:50008045-50008067 CTGGTTGGTCAACCAAACCCAGG - Intronic
953841855 3:46395760-46395782 CTGGTTCTGCCCCCAAGCCCTGG + Intergenic
954384360 3:50236554-50236576 CTGTCTGGGACCCCACACCTGGG + Intronic
955761529 3:62289348-62289370 CTGTTAGGGCCCACAAGTCCTGG + Intronic
957636417 3:82791220-82791242 CTTTTTGGGAGCCCAAACCTAGG + Intergenic
961666134 3:128493980-128494002 CTGTCTTTGCCCACAAACCCAGG - Intergenic
962804315 3:138915962-138915984 TTGCTTTGGCCCCAAAACCCTGG - Intergenic
965965352 3:174482216-174482238 CTGGTTGGGCCCCCTAATTCTGG + Intronic
968810652 4:2798315-2798337 CTCTTTGGGACCCAAAGCCCTGG - Intronic
980078891 4:128322996-128323018 CTGTTGGGACCTCCAGACCCTGG - Intergenic
989169392 5:38459732-38459754 CTTGCTGGGCCCCCAACCCCTGG + Intronic
993287346 5:86016308-86016330 CTCTTTGGGTCCCCAAGTCCAGG - Intergenic
994722140 5:103392645-103392667 TTGTTTGGGCACCAAAACCCCGG - Intergenic
997915642 5:137922175-137922197 CTATTTGGGCCTCCTAACCAAGG + Intronic
1002093291 5:176817168-176817190 CTGGTGGGGCCCCCAGAGCCGGG + Intronic
1007856351 6:44862297-44862319 CTTTTTGGAACCCCAAAACCAGG + Intronic
1011023931 6:82845657-82845679 CTGTTGGGGTCCCCAATTCCAGG + Intergenic
1013282037 6:108647511-108647533 GTGTTTTGGCCACCAAACACAGG - Intronic
1021469085 7:20980879-20980901 CTGTTTGGGCCCACATGCTCCGG + Intergenic
1022415750 7:30175565-30175587 GTGTGTGGGCACCCAAGCCCTGG + Intergenic
1022648796 7:32256307-32256329 CTGTTTGGAGCCACAAACCAGGG + Intronic
1024668421 7:51567809-51567831 TTGGTTGGGGCCCTAAACCCAGG + Intergenic
1034246468 7:149648396-149648418 CTGTATGAGCCCCAAAACTCAGG + Intergenic
1034459598 7:151191190-151191212 CTAATAGGACCCCCAAACCCAGG - Intronic
1035024518 7:155817180-155817202 CTGCTTGGCCCCCCAGCCCCTGG + Intergenic
1035139107 7:156739020-156739042 CTCTTGGGGCCCCCGAAACCAGG + Intronic
1035221829 7:157410768-157410790 CGCTTCGGTCCCCCAAACCCAGG - Intronic
1037636923 8:20708505-20708527 CTAATTGGGCCACCAAACCCAGG + Intergenic
1037937836 8:22927311-22927333 CTGCTTGGGCCCTCCAAACCTGG - Intronic
1038495851 8:28001877-28001899 CTGTCTGGACCCCAGAACCCTGG + Intergenic
1038699572 8:29837064-29837086 CTTTTTGGTCTCCCATACCCTGG - Intergenic
1041823293 8:62063599-62063621 CTCTTGGGGTCCCCAAACCCAGG + Intergenic
1043687955 8:83111913-83111935 CTGCTATGGCCCCCACACCCAGG + Intergenic
1047212583 8:122851746-122851768 CTTTCTGAGCCCCCAAGCCCCGG - Intronic
1048285321 8:133136938-133136960 CTGTCTGAGCCCCCAGATCCTGG - Intergenic
1052063316 9:23987161-23987183 CTCTTGGGGTCCCCAATCCCAGG + Intergenic
1058287124 9:103192099-103192121 CAGTTGGGGTCCCCAACCCCTGG + Intergenic
1060661982 9:125409633-125409655 GTGTCTGGGCCCCCAAGCTCTGG - Intergenic
1060819268 9:126652030-126652052 CTGTTGGGACCCCCAAGCCTTGG - Intronic
1061545382 9:131301441-131301463 CTGTTCGGGCACCCAGACCCTGG + Intronic
1062031211 9:134362855-134362877 CTGTGTGTGCCCCCATGCCCGGG + Intronic
1190581247 X:51894411-51894433 CTCTTTGGTCTCCCAAACGCCGG + Intronic
1192400258 X:70827434-70827456 CTCTTGGGGTCCCCAAATCCAGG + Intronic
1193227206 X:78998262-78998284 GTGTTTGGGACCCAAAGCCCTGG - Intergenic
1194823420 X:98532302-98532324 CTCTTGGGGTCCCCAATCCCAGG + Intergenic
1195685308 X:107579629-107579651 CTTTCTGGGCCCTCAAACCCAGG - Intronic
1199673168 X:150163461-150163483 CTGTGTGGGGCCTCAAATCCTGG - Intergenic
1200048444 X:153415130-153415152 CTCATTGGGCCCCCACACTCTGG - Intergenic
1200254911 X:154575449-154575471 TTGAGTGGGCCCCCAATCCCAGG - Intergenic
1200262858 X:154628959-154628981 TTGAGTGGGCCCCCAATCCCAGG + Intergenic