ID: 1182458741

View in Genome Browser
Species Human (GRCh38)
Location 22:30469669-30469691
Sequence CTGTTTGGGCCCCCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182458741_1182458749 14 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458749 22:30469706-30469728 CCCAGCCCTACCTTGGGCTATGG No data
1182458741_1182458746 7 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458746 22:30469699-30469721 CATAAATCCCAGCCCTACCTTGG No data
1182458741_1182458751 15 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458751 22:30469707-30469729 CCAGCCCTACCTTGGGCTATGGG No data
1182458741_1182458747 8 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458747 22:30469700-30469722 ATAAATCCCAGCCCTACCTTGGG No data
1182458741_1182458755 23 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458755 22:30469715-30469737 ACCTTGGGCTATGGGACTGTGGG No data
1182458741_1182458754 22 Left 1182458741 22:30469669-30469691 CCTGGGTTTGGGGGCCCAAACAG No data
Right 1182458754 22:30469714-30469736 TACCTTGGGCTATGGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182458741 Original CRISPR CTGTTTGGGCCCCCAAACCC AGG (reversed) Intronic