ID: 1182459136

View in Genome Browser
Species Human (GRCh38)
Location 22:30471873-30471895
Sequence TCTTCCGGAACTCCAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182459121_1182459136 -2 Left 1182459121 22:30471852-30471874 CCCCCAGCCCCTTTCCCCTGGTC 0: 1
1: 0
2: 6
3: 72
4: 719
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459124_1182459136 -5 Left 1182459124 22:30471855-30471877 CCAGCCCCTTTCCCCTGGTCTTC 0: 1
1: 0
2: 0
3: 54
4: 637
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459117_1182459136 12 Left 1182459117 22:30471838-30471860 CCACTTCTTTCCACCCCCCAGCC 0: 1
1: 0
2: 6
3: 136
4: 1104
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459122_1182459136 -3 Left 1182459122 22:30471853-30471875 CCCCAGCCCCTTTCCCCTGGTCT 0: 1
1: 1
2: 4
3: 82
4: 655
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459118_1182459136 2 Left 1182459118 22:30471848-30471870 CCACCCCCCAGCCCCTTTCCCCT 0: 1
1: 3
2: 22
3: 274
4: 2750
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459120_1182459136 -1 Left 1182459120 22:30471851-30471873 CCCCCCAGCCCCTTTCCCCTGGT 0: 1
1: 0
2: 5
3: 70
4: 651
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459127_1182459136 -10 Left 1182459127 22:30471860-30471882 CCCTTTCCCCTGGTCTTCCGGAA 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459126_1182459136 -9 Left 1182459126 22:30471859-30471881 CCCCTTTCCCCTGGTCTTCCGGA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459116_1182459136 16 Left 1182459116 22:30471834-30471856 CCAGCCACTTCTTTCCACCCCCC 0: 1
1: 0
2: 1
3: 66
4: 672
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1182459123_1182459136 -4 Left 1182459123 22:30471854-30471876 CCCAGCCCCTTTCCCCTGGTCTT 0: 1
1: 0
2: 1
3: 44
4: 519
Right 1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182459136 Original CRISPR TCTTCCGGAACTCCAGGGGG AGG Intronic
901231430 1:7643568-7643590 GCTTTATGAACTCCAGGGGGTGG + Intronic
902694085 1:18128635-18128657 TCTTGCAGAACTCCACGTGGTGG + Intronic
904800024 1:33086014-33086036 GCTTCAGGAACCCCAGGGGGAGG + Intronic
905653063 1:39669250-39669272 TCCTCAGGAAGTCCAGGTGGGGG - Intronic
907155054 1:52325981-52326003 TTTTCCGGGACTCCAAGGGTGGG + Intronic
907461028 1:54605597-54605619 GCTTCCGGAACTGCTGGGGGTGG + Intronic
908738853 1:67307283-67307305 TCTGCCCGCACTCCAGTGGGCGG + Intergenic
909146066 1:71933639-71933661 TATTCAGGGACTCCAGAGGGTGG - Intronic
911725802 1:101239680-101239702 TCTTGCGGAACGTCAGGCGGCGG - Exonic
912659568 1:111515834-111515856 TCCTCCGGAACTCCGGGAGCCGG + Intronic
916213106 1:162374236-162374258 TCTTGAGGAAGTCCAGGGTGGGG + Exonic
919445051 1:197692898-197692920 TCTTCCTGAACTCCAGTCAGAGG + Intronic
1070718268 10:78738477-78738499 TCTTAGGGAACTCCAGGAAGAGG + Intergenic
1075653758 10:124147534-124147556 TCTGCCTGAACCCCAGGAGGTGG - Intergenic
1075695112 10:124428536-124428558 GCTTCCCAAACTCCAGGGAGTGG - Intergenic
1077874296 11:6291013-6291035 TCTTCCCCAACACCAGTGGGAGG - Intergenic
1078215886 11:9311541-9311563 CCTTGCGGAGCTCCTGGGGGAGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081584036 11:44371987-44372009 TCTCCTGGAACACCAGGGTGGGG - Intergenic
1084693507 11:70740448-70740470 GCTTCAGGAACTCAAGGTGGAGG - Intronic
1085476769 11:76794015-76794037 CCTTCCTGAAGTCCAGAGGGAGG + Intronic
1086492562 11:87370158-87370180 GCTTCAGGAACTACTGGGGGAGG - Intergenic
1097102854 12:56601589-56601611 TCCTCAGAAACTGCAGGGGGCGG + Exonic
1098879290 12:75900629-75900651 TCTCCCCTAACTCCAGGGAGGGG + Intergenic
1103252532 12:119512582-119512604 TCTTCCAGAACCCCAGAGGAGGG + Intronic
1103738022 12:123072841-123072863 TCTTCCAGAGCTCCAGGTGAGGG - Intronic
1106759911 13:32858280-32858302 CCCTCCGGAACACCGGGGGGAGG + Intergenic
1108532553 13:51341265-51341287 ACTGCAGGATCTCCAGGGGGAGG - Exonic
1110436952 13:75486091-75486113 TCTTGTGGATCTCCAGGGAGGGG + Intergenic
1111956811 13:94768152-94768174 TCTTCCAGTACTACAGTGGGGGG + Intergenic
1114269841 14:21093937-21093959 TCTTCCCCACCGCCAGGGGGTGG - Intronic
1114717586 14:24844013-24844035 TCATCCTGACCTCCAGGGAGGGG + Intronic
1119458959 14:74781943-74781965 CCTTGTGGAACTCCAGGGGGAGG - Exonic
1119806817 14:77487629-77487651 CCTTGCGGAACTCCTGGGAGTGG + Intronic
1123135781 14:106026478-106026500 GCTTCCGGAGCTCCAGGGAAGGG - Intergenic
1124362274 15:29046441-29046463 TCTTCCCCTACTCCAGGGGGTGG - Intronic
1125721879 15:41849175-41849197 GCTTCAGGCTCTCCAGGGGGAGG - Intronic
1128383099 15:67127634-67127656 TCTTCAGGAACTCCAGAGACGGG - Intronic
1131833016 15:96366265-96366287 TACACAGGAACTCCAGGGGGCGG + Intergenic
1132162581 15:99556704-99556726 CCTTCCAGGACTCCAGGGGTGGG + Intergenic
1132889797 16:2197809-2197831 TCTTCCAGCACTCCTGGGAGGGG + Intergenic
1133014475 16:2933137-2933159 TCCTCAGGAACTCGAGGGGCCGG - Exonic
1133015626 16:2938191-2938213 TCCTCAGGAACTCCAGGGGCCGG - Exonic
1133640743 16:7714939-7714961 TCTGCCCACACTCCAGGGGGAGG - Intergenic
1134363434 16:13554169-13554191 TCTTCCTCACCTCCAGGGGTGGG + Intergenic
1134368797 16:13604567-13604589 TCTTCCAGGACTCCAGGGAAGGG - Intergenic
1135085876 16:19474112-19474134 TCTTCAGGAACTGCAGGGGATGG - Exonic
1135228015 16:20678431-20678453 GTTTCCTGAACTCCTGGGGGTGG - Intronic
1136021678 16:27444589-27444611 CTTTGCGGAACTCCAGGGGGAGG - Exonic
1136999487 16:35216625-35216647 TCCTCTGGACCTCCAGGGGTGGG - Intergenic
1137003463 16:35251381-35251403 TCCTCTGGACCTCCAGGGGTGGG + Intergenic
1137393070 16:48097603-48097625 GAATGCGGAACTCCAGGGGGTGG - Intronic
1137548154 16:49418283-49418305 TCTTCAGGAATCCCAGGGGCTGG + Intergenic
1139105641 16:63823628-63823650 TCTTGCTGAAATCCAGGGAGAGG - Intergenic
1139573665 16:67828317-67828339 GCTGCCGGTACTCCAGGGGCAGG + Exonic
1141859148 16:86704662-86704684 CCTTCAGGAAGTCCAGGTGGGGG + Intergenic
1143676536 17:8436588-8436610 CTTTGCCGAACTCCAGGGGGAGG - Intronic
1144389898 17:14784032-14784054 CCTTCCGAAACTGCAAGGGGTGG - Intergenic
1147880376 17:43649724-43649746 TCTTCCAGAACTGCGGAGGGAGG + Intronic
1151460677 17:74252406-74252428 TCTCCCAGAACTCCAGGCTGTGG - Intronic
1152696580 17:81800633-81800655 CCTTGCAGAACTCCAGGGTGGGG + Intergenic
1153894279 18:9544416-9544438 AATTACTGAACTCCAGGGGGTGG + Intergenic
1163168151 19:15511728-15511750 TCTTCTTGAACTGCAGGGGCTGG - Intronic
1163413703 19:17172749-17172771 TCTCCCGGAAGTCCTGGTGGGGG - Exonic
1167456263 19:49597863-49597885 TGGTCGGGACCTCCAGGGGGCGG - Exonic
1168056925 19:53869310-53869332 TCTCCCGGATTTCCGGGGGGTGG - Intronic
1168639273 19:58020023-58020045 TCTTCAGGGACTCCCGGGTGGGG + Intergenic
926130694 2:10302096-10302118 TTTTCCGGAGCTCCTGGTGGGGG + Intergenic
928431105 2:31219053-31219075 TTTTCAGGGACTCCAGGTGGGGG + Intronic
929945212 2:46366079-46366101 TCTTGCGTGACTCCAGGCGGTGG + Intronic
936320058 2:111459597-111459619 CCCTGTGGAACTCCAGGGGGGGG + Intergenic
937002731 2:118482992-118483014 CCTTCCAGAACCCCAGGGGCAGG - Intergenic
938244068 2:129763873-129763895 TGTTTGGGGACTCCAGGGGGAGG - Intergenic
947746800 2:232512124-232512146 TCTTCCGAAGATCCAGGTGGTGG + Intergenic
947828686 2:233124192-233124214 TCTTCCTGAATTCCAGCAGGTGG + Intronic
948593995 2:239067899-239067921 TCCTCGGGGACTCCAGGGTGGGG + Intronic
948628960 2:239289587-239289609 TCTTCTGGAAATCCAGGCTGGGG + Intronic
1170523983 20:17218279-17218301 TCCTCCAGTACTCTAGGGGGAGG + Intergenic
1172936055 20:38621144-38621166 ACTTCAGGGACTCCAGGGGATGG + Intronic
1173799574 20:45886677-45886699 TCTTCCCGAACTCCTGGGACGGG + Exonic
1174164787 20:48576934-48576956 TCATCCGGAGCTCCAGGCAGAGG - Intergenic
1174192306 20:48749174-48749196 TTTGCCGGAACTCCAGGATGTGG + Intronic
1176383626 21:6126345-6126367 TCTTCCAGAACTCCTGATGGTGG + Intergenic
1177161737 21:17555140-17555162 CCTTCCAGAGCTCCAGGGGAAGG - Intronic
1179248322 21:39652087-39652109 TCTCTTGGAGCTCCAGGGGGAGG - Intronic
1179739844 21:43411893-43411915 TCTTCCAGAACTCCTGATGGTGG - Intergenic
1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG + Intronic
1183111712 22:35654280-35654302 TCTCCTGGAACTCAAGGGGTAGG + Intronic
960496464 3:118381710-118381732 TCTACCAGATCTCCATGGGGAGG - Intergenic
961543969 3:127619155-127619177 TCTTCAGGACCTCCTGGGGCAGG - Exonic
962835327 3:139184545-139184567 TCTGCTGGAACCCTAGGGGGAGG + Intronic
964758148 3:160107405-160107427 TCTTGTGCAACTCCAGTGGGAGG + Intergenic
966516837 3:180829019-180829041 TCCTCAGGAACTCAAGGGGCCGG + Intronic
966516961 3:180829495-180829517 TCCTCAGGAACTCCAGGGAATGG + Intronic
969105752 4:4805973-4805995 TCTTCCTGGACTTCAGGGGCTGG + Intergenic
979386241 4:120068180-120068202 TCTACCCAAACTCCAGGGGAGGG + Intergenic
986840258 5:11688269-11688291 TCTTCCGGGAGTTCAGGTGGGGG - Intronic
986841948 5:11707525-11707547 TCTTCCTGAACTACAGAGGCTGG - Intronic
994536896 5:101042623-101042645 TCTTCAGTTACTCCAGGGGAAGG + Intergenic
1002169344 5:177366698-177366720 TCTTCAGGAACTCCTGGGAGGGG - Exonic
1011712615 6:90069981-90070003 TCTTCCTCAGCTCCAGAGGGTGG + Intronic
1019596127 7:1859192-1859214 TCTTCCTTCACACCAGGGGGAGG - Intronic
1020740505 7:12010331-12010353 TCTTCTACAACTCCAGTGGGAGG - Intergenic
1022097128 7:27148032-27148054 TCTTCCCGAACGCCAGCGGCGGG + Intronic
1024034508 7:45495802-45495824 TCTTCCTGAATTCCAGAGGGAGG + Intergenic
1026827495 7:73593689-73593711 TCTTCTTGACCTCCAGGAGGTGG + Exonic
1026858203 7:73768824-73768846 TCTTCCGAATCCCCAGGGAGTGG + Intergenic
1029503765 7:100949866-100949888 TCTTCCAGAGCTCCAGGTGCAGG + Intronic
1037949009 8:23006878-23006900 ACTTCCAGAACTGCAGGTGGCGG - Exonic
1039077443 8:33704580-33704602 TTTTCTGGAACTTCAAGGGGAGG - Intergenic
1041487374 8:58393707-58393729 TCTTCCTGTACTTCAGGGGCTGG + Intergenic
1045321518 8:101085384-101085406 ACTTCCCGGATTCCAGGGGGTGG - Intergenic
1047517709 8:125569506-125569528 GCTTCCGGAAGCCCAGAGGGAGG - Intergenic
1052409510 9:28105194-28105216 TGTTCTGAAACACCAGGGGGTGG + Intronic
1055795680 9:79972527-79972549 TCTTCCGGATTGCCAGGGGAAGG + Intergenic
1057568555 9:96185913-96185935 TCTTCCTGAACTTGAGTGGGTGG - Intergenic
1058504667 9:105655895-105655917 TGTTGCTGAACTCCAGGTGGAGG + Intergenic
1058877747 9:109259031-109259053 GCTTCCTGAGCTGCAGGGGGTGG - Intronic
1060110340 9:120902271-120902293 CCTTCGGGAACTGCTGGGGGTGG + Intergenic
1060695707 9:125707215-125707237 ACTTCCGGAACGCCGGGGTGTGG - Exonic
1060968210 9:127723327-127723349 TCTTCCGGTACTGCATGGGAAGG + Exonic
1061056323 9:128224722-128224744 TCTTTGGGAGCTCCAGGGAGGGG + Intronic
1061929157 9:133823566-133823588 TGTTCTGGAACTCCAGGAAGAGG - Intronic
1192800331 X:74459430-74459452 TCTTCCAAAACTCCAGGGACTGG - Intronic
1200125513 X:153812321-153812343 TCTTCCTGAACTCCCGGGGCAGG + Intronic