ID: 1182464446

View in Genome Browser
Species Human (GRCh38)
Location 22:30505720-30505742
Sequence CGCCCCGACGGGAGAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182464431_1182464446 27 Left 1182464431 22:30505670-30505692 CCTTGTATCCGCTGCCGCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464436_1182464446 10 Left 1182464436 22:30505687-30505709 CCTGGTTGTGCCTCCTGGGCCAG 0: 1
1: 0
2: 3
3: 21
4: 270
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464438_1182464446 0 Left 1182464438 22:30505697-30505719 CCTCCTGGGCCAGATGTTGGTCC 0: 1
1: 0
2: 0
3: 5
4: 145
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464435_1182464446 13 Left 1182464435 22:30505684-30505706 CCGCCTGGTTGTGCCTCCTGGGC 0: 1
1: 0
2: 1
3: 24
4: 366
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464432_1182464446 19 Left 1182464432 22:30505678-30505700 CCGCTGCCGCCTGGTTGTGCCTC 0: 1
1: 0
2: 1
3: 17
4: 171
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464440_1182464446 -9 Left 1182464440 22:30505706-30505728 CCAGATGTTGGTCCCGCCCCGAC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79
1182464439_1182464446 -3 Left 1182464439 22:30505700-30505722 CCTGGGCCAGATGTTGGTCCCGC 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182464446 Original CRISPR CGCCCCGACGGGAGAGGCAC TGG Intergenic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
901022385 1:6261747-6261769 CGCCCAGCCGGGAGAGGCCAGGG + Intergenic
904453561 1:30632478-30632500 CCCCCCAAAGGGAGAGGCAAAGG - Intergenic
908861773 1:68497257-68497279 CGCCTCGATGGGACAGGCTCGGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922919955 1:229293841-229293863 AGCCCAGACGGGAGTGGCAGGGG + Intronic
1065967582 10:30781932-30781954 CGCTCCCACGTGATAGGCACGGG - Intergenic
1069898270 10:71692286-71692308 AGCCCCGACTGGGGAGGCAAGGG - Intronic
1073379306 10:103065985-103066007 GGCCCCGGCAGGAGAGGGACAGG - Intronic
1076275249 10:129192981-129193003 CTCCCCAACAGGGGAGGCACAGG + Intergenic
1077124622 11:926806-926828 CACCCCGAGGGGACAGGCACGGG - Intronic
1083168368 11:60906202-60906224 CGCTCCGACGGGGGGGGCTCCGG + Intronic
1084680146 11:70662281-70662303 CGCCGGGACGGGAGAGGGAGGGG - Intronic
1085321462 11:75576634-75576656 CGCCCCGAGGGATGGGGCACTGG - Intergenic
1085516105 11:77112829-77112851 GGCCCAGACGGGGGTGGCACCGG + Intronic
1094658115 12:32440737-32440759 CGCCCTGAAGGGAATGGCACAGG - Intronic
1096616104 12:52834391-52834413 CGCCCCAAGGGGAGAGGGAGGGG + Intergenic
1096984068 12:55744894-55744916 CACCCCCATGGGAGAGGCACAGG + Intronic
1097232808 12:57522694-57522716 TGCCCGGACGGGAGAGGGGCGGG - Intronic
1097426015 12:59445771-59445793 CTCCCTGAAGGGAGAGTCACAGG - Intergenic
1098249949 12:68559163-68559185 CTCCCTGACGGCAGAGGCATTGG - Intergenic
1101660238 12:106759109-106759131 GGCCCCGGCCCGAGAGGCACAGG + Intronic
1103775688 12:123364861-123364883 CGCCCCGCCGGGAGGGGCGGGGG + Intergenic
1105699730 13:22926855-22926877 TGCCCCGACGGCAGGTGCACCGG + Intergenic
1113483759 13:110640124-110640146 AGCCACCACGGGAGAGGCGCTGG - Intergenic
1118210525 14:63761926-63761948 CGACCCGCGGGGAGCGGCACGGG + Intergenic
1120107698 14:80515590-80515612 TGCCCTGAAGGGAGAGGCCCAGG - Intronic
1120994021 14:90401693-90401715 CGCCCAGGCTGGAGTGGCACTGG + Intronic
1126503870 15:49380254-49380276 CGCCCTGAAGGGTGAGGCCCAGG - Intronic
1127211671 15:56780068-56780090 AGCCCCGATGGGAGATCCACTGG + Intronic
1127588042 15:60397139-60397161 CGGCCAGAAGGGAGAGGCCCCGG + Intronic
1130540273 15:84817144-84817166 CGCCGCGTCTGGAGAGGCCCGGG - Exonic
1132660773 16:1060596-1060618 CGCCCCGGGGGTACAGGCACCGG + Intergenic
1132841202 16:1979234-1979256 CGACCCGGCGGGTGAGGCCCGGG - Exonic
1132978269 16:2721154-2721176 CGCCGCGGCGGAAGAGGCTCGGG + Intergenic
1136556693 16:31011184-31011206 CACCGCGGCGGGAGAGGCCCAGG - Intergenic
1139446452 16:67001257-67001279 CGCCCCGACTGTCGAGGCCCGGG + Intronic
1140214335 16:72995297-72995319 CACCCAGATTGGAGAGGCACGGG - Intronic
1141723190 16:85768209-85768231 CACCCTGACGGGAGAGTCCCAGG + Intergenic
1142093976 16:88229909-88229931 CGCGCCCCCGGGAGAGCCACTGG - Intergenic
1142860126 17:2756030-2756052 CGCCCCCGCGGGAGGGGGACGGG - Intergenic
1148786825 17:50149715-50149737 CGCCCCGTCGGGGGATGCCCCGG - Exonic
1154414579 18:14170312-14170334 GGCCATGACGGGAGAGGGACAGG + Intergenic
1158137574 18:54224162-54224184 CTCCCCGACGGGAAAGGGACCGG + Exonic
1159938274 18:74385912-74385934 CGCCCCGAGGGGAGAATCATGGG - Intergenic
1163386200 19:17001861-17001883 TGCCCCCAGGGGAGGGGCACGGG + Intronic
1164874553 19:31674512-31674534 CACCCCAAGGGGAGAGCCACTGG + Intergenic
1165108354 19:33487412-33487434 GGCCCCGAGGGGAGAGACATGGG + Intronic
1166177068 19:41081774-41081796 CACCCAGATGGGGGAGGCACAGG - Intergenic
1166361652 19:42255066-42255088 CGGCCCGACGGGCGCGGGACGGG - Exonic
1168252658 19:55149252-55149274 CGCCCCGAGGGGAGAGGGAGGGG + Exonic
932406074 2:71513322-71513344 GGCCCCCACGGGTGAGACACGGG + Exonic
936940364 2:117878351-117878373 TGCCCTGAAGGGAGAGTCACAGG - Intergenic
937183103 2:120013350-120013372 CGGCCCGACGAGAGAGGGGCCGG - Intronic
939186987 2:138872348-138872370 CTCCCAGACGGGAGAGGGAGAGG + Intergenic
940008245 2:149029565-149029587 CCCTCAGACAGGAGAGGCACAGG - Intergenic
1175108734 20:56631208-56631230 CGCCACGACGGGAGCAGCAATGG + Exonic
1175950904 20:62582492-62582514 AGCCCCGACGGGAGAGACTGTGG + Intergenic
1182464446 22:30505720-30505742 CGCCCCGACGGGAGAGGCACTGG + Intergenic
1184246040 22:43236215-43236237 AGCCCTGGCTGGAGAGGCACAGG - Intronic
1184978670 22:48080975-48080997 AGGCCCCACGGCAGAGGCACCGG + Intergenic
960153506 3:114274865-114274887 TGCCCCGAAGGGAGAGTCTCAGG - Intergenic
975778996 4:77819726-77819748 CCGCCGGAGGGGAGAGGCACCGG + Intergenic
980328429 4:131379398-131379420 CGCGCCGGCGGGAGCGCCACCGG - Intergenic
987108671 5:14664760-14664782 CACCCCGACGGGAGGGGCTCCGG + Exonic
989351977 5:40497012-40497034 CCCCCCCACAGCAGAGGCACAGG + Intergenic
991913914 5:71587463-71587485 CGGCCCGGCGGGAGAGGCGCGGG - Exonic
992039604 5:72816826-72816848 CGCGCCTACGGGAGAGACGCCGG + Intronic
992088468 5:73298370-73298392 CGGCCCGGCGGGGGACGCACAGG + Intergenic
996653623 5:125913421-125913443 TGCCCTAAAGGGAGAGGCACAGG - Intergenic
997470123 5:134113087-134113109 TGCCCGGAGGGGAGAGGTACAGG - Intergenic
998071119 5:139198514-139198536 CCCCCCAAGGGGAGGGGCACGGG - Intronic
1023817457 7:43961742-43961764 GGCCCTGCAGGGAGAGGCACGGG + Intergenic
1029742082 7:102496616-102496638 GGCCCTGCAGGGAGAGGCACGGG + Exonic
1029760071 7:102595781-102595803 GGCCCTGCAGGGAGAGGCACGGG + Exonic
1034581754 7:152049984-152050006 TGCCCCGAAGGGAGAGTCTCAGG - Intronic
1038493367 8:27985392-27985414 AGCACAGAGGGGAGAGGCACAGG + Intronic
1039039805 8:33396215-33396237 CGCTTCGACTGGAGAGGCACAGG - Intronic
1041244757 8:55879833-55879855 CGGCGCGGCGGGAGAGGAACTGG - Exonic
1043769892 8:84184680-84184702 CGCCCCGCCGGGAGACGACCTGG - Intronic
1044395143 8:91702674-91702696 CACCCTGAAGGGAGAGACACAGG - Intergenic
1047423930 8:124728664-124728686 CGCACCGGAGGGAGAGGCTCCGG - Intergenic
1047650424 8:126914376-126914398 AGGCCCCACAGGAGAGGCACAGG + Intergenic
1047911838 8:129538801-129538823 CACCCAGAGGTGAGAGGCACTGG - Intergenic
1186466191 X:9786230-9786252 CGGCCCGAAGGGTGAGGGACGGG - Intronic
1194387803 X:93278416-93278438 TGCCCCGAAGGGAGAGACCCAGG + Intergenic
1194481034 X:94424626-94424648 CGCCCCGAAGGGAAGGACACAGG - Intergenic
1196828433 X:119758589-119758611 GGCCCCAACGGGAGAGGAACTGG - Intergenic