ID: 1182468738

View in Genome Browser
Species Human (GRCh38)
Location 22:30533957-30533979
Sequence AACAGGACCAGGCTAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182468732_1182468738 -4 Left 1182468732 22:30533938-30533960 CCTCAGACTTGGGATAGGAAACA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 1182468738 22:30533957-30533979 AACAGGACCAGGCTAGGCAGGGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182468738 Original CRISPR AACAGGACCAGGCTAGGCAG GGG Intronic