ID: 1182469148

View in Genome Browser
Species Human (GRCh38)
Location 22:30536691-30536713
Sequence TTGAACAAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1473
Summary {0: 1, 1: 0, 2: 12, 3: 175, 4: 1285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182469141_1182469148 -9 Left 1182469141 22:30536677-30536699 CCTACCTAATTGGGTTGAACAAG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG 0: 1
1: 0
2: 12
3: 175
4: 1285
1182469138_1182469148 20 Left 1182469138 22:30536648-30536670 CCAATGCAAAAACAAAGCTAACA 0: 1
1: 0
2: 1
3: 24
4: 372
Right 1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG 0: 1
1: 0
2: 12
3: 175
4: 1285
1182469137_1182469148 23 Left 1182469137 22:30536645-30536667 CCTCCAATGCAAAAACAAAGCTA 0: 1
1: 0
2: 3
3: 27
4: 289
Right 1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG 0: 1
1: 0
2: 12
3: 175
4: 1285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182469148 Original CRISPR TTGAACAAGGAGGAGGAGGA GGG Intronic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900297873 1:1961179-1961201 TTTCAAAAGGAGGAGCAGGAGGG + Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900752275 1:4406124-4406146 TTAACCAGAGAGGAGGAGGAGGG + Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901908364 1:12433888-12433910 TTTTACAAAGAGGAGGAGGTAGG + Intronic
902162804 1:14545308-14545330 TTGCACATGGAGGAGAAGAAAGG - Intergenic
903311566 1:22461999-22462021 TTGAACAAGTAGGAAGTGGCAGG + Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
904016880 1:27428521-27428543 TTGAAGCAGGTGGAGGGGGAGGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904479169 1:30783281-30783303 TTGAAGAGGGAGGCGGTGGAGGG - Intergenic
904479764 1:30786563-30786585 CTGAGCAAGGAGGTGGAGGGAGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904893177 1:33794534-33794556 TTAAGCAAGGAGGTGGTGGAGGG + Intronic
905271900 1:36792774-36792796 TTGAGCAAGGAAGCGGAGGGGGG + Intergenic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905668363 1:39775737-39775759 TGGAACAAGCTGGAAGAGGAAGG + Intronic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
905961340 1:42045023-42045045 TTGAACCAATAGGAAGAGGAGGG - Intergenic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906502259 1:46349883-46349905 TTGAACTAGGAGGAGGAAGAAGG + Intronic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907610609 1:55866261-55866283 TTCTACAAGGAGGATAAGGAAGG + Intergenic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
907806255 1:57823385-57823407 TTGGACACCGAGGAAGAGGAAGG + Intronic
908053145 1:60255018-60255040 TTGAACTGGGAGAAGGAAGAGGG - Intergenic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909797834 1:79765433-79765455 TTAATCAAGAAAGAGGAGGATGG - Intergenic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910007902 1:82422289-82422311 GTGAAGTAGGAGGAGGAAGAAGG + Intergenic
910204469 1:84734385-84734407 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
910581437 1:88829960-88829982 TTGGAAAAGGAGGAGAAGTATGG + Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911290261 1:96048941-96048963 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
911701054 1:100952024-100952046 TTGAAGATGGAGGAAGAGGCCGG + Intronic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912454297 1:109787499-109787521 TTTGTCTAGGAGGAGGAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
913344163 1:117791481-117791503 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915182469 1:154074379-154074401 TTGAGGAAGGAAGAGAAGGAGGG - Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915923805 1:160000595-160000617 TTGAACAGGGCGGTGGGGGAGGG + Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916053801 1:161053820-161053842 TTGCACAGGGAGGAGGTGGGTGG + Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916128465 1:161591549-161591571 TTGACCAATGAGCAGGAGTAGGG + Intronic
916138381 1:161673380-161673402 TTGACCAATGAGCAGGAGTAGGG + Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917863396 1:179170291-179170313 TTGAAAAAGTAGTAGGAGGTGGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918585900 1:186188050-186188072 TTGGTCAAGGAGTGGGAGGAAGG - Intronic
918673879 1:187257487-187257509 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920400524 1:205673307-205673329 ATGAACATGGAGGGGGAAGAGGG + Intronic
920416482 1:205802129-205802151 TTGGAGAGGGAGGAGGAGGCAGG + Intronic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
920916596 1:210262581-210262603 TGGAAAAATGAGGAGAAGGAAGG - Intergenic
921315749 1:213888553-213888575 TTGGAGAAAGAGGAGGAGTAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
922724989 1:227918461-227918483 GGGACCAGGGAGGAGGAGGAAGG - Intergenic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
922998447 1:229985404-229985426 TTGAACATGGTGGAGGGGGAGGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923651916 1:235882185-235882207 TTGAAAAAAGAGGAGGAGTTTGG + Intronic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
924602633 1:245504753-245504775 TTTAACTAAGAGGAGAAGGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1062961602 10:1576798-1576820 TTGAAGGTGGAGGATGAGGAGGG + Intronic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063219298 10:3951134-3951156 TTGAACTCGGTGGTGGAGGAGGG - Intergenic
1063245306 10:4211736-4211758 TGGGCCGAGGAGGAGGAGGAAGG + Intergenic
1063410812 10:5835182-5835204 TTAAACAAGGAGGAGAATGTTGG + Intronic
1063437882 10:6049282-6049304 TAGAACAAGAAGGCAGAGGAAGG - Intronic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064904775 10:20333917-20333939 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1064982635 10:21179781-21179803 TTGAAGACGGAGGAAGGGGAAGG + Intergenic
1065500860 10:26381097-26381119 GTGAAAGAGGAGGAGGAGGGAGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065747908 10:28858715-28858737 TTGAGCAAGGAGCAAGATGAAGG - Intronic
1065795041 10:29298843-29298865 ATGAACCAGAGGGAGGAGGATGG + Intronic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067665062 10:48270697-48270719 TTGAAAGAGGAGGAGGTGGGGGG - Intronic
1067784988 10:49239329-49239351 TTGAGCAAGCAGGGAGAGGATGG + Intergenic
1067921673 10:50464804-50464826 TGGAACAAAGAAGGGGAGGAGGG + Intronic
1068123873 10:52813931-52813953 TTGGAGAGGGAGGAGGAGTAAGG - Intergenic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068460898 10:57327045-57327067 TAAAAAAAGGAGGAGGAAGAAGG - Intergenic
1068465678 10:57387388-57387410 TAGAACAAAGAGGCAGAGGAAGG - Intergenic
1068805075 10:61186153-61186175 TTGAACCACTAAGAGGAGGAAGG + Intergenic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069194429 10:65531361-65531383 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069653313 10:70067881-70067903 TTGAAAAGGGAGGAGGAAGGTGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070541273 10:77417110-77417132 TTGATCAGGGAGGATGAAGATGG - Intronic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1070953671 10:80450708-80450730 TAGAACAAGGAGGAAGGAGATGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071816875 10:89241145-89241167 GTTAACCAGGAGGAAGAGGAGGG + Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072684056 10:97527088-97527110 TTGAACCAGGAGGCGGAGGTTGG + Intronic
1072763010 10:98073280-98073302 CTAAGCAAGGAGGAGGAGAATGG + Intergenic
1073017949 10:100417029-100417051 TTGATTAAGGTGGCGGAGGACGG + Intergenic
1073586466 10:104715278-104715300 TAGAACAAAAAGGAGGAGAAAGG + Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074361841 10:112830054-112830076 TTGACCAGGGAGGAGGAGAATGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074561899 10:114542572-114542594 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074977521 10:118593772-118593794 TTCACCAACGAGCAGGAGGAGGG + Exonic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1077210773 11:1370091-1370113 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078139342 11:8680860-8680882 GTGACCAAAGAGTAGGAGGAAGG + Intergenic
1078448935 11:11426036-11426058 TTTGACAAGGAAGATGAGGAGGG + Intronic
1078452874 11:11453281-11453303 TTTAACAAGAAGGTGGCGGAAGG - Intronic
1078480635 11:11672366-11672388 TTGAGCAAGGCGGAGGTGCATGG - Intergenic
1078501223 11:11879568-11879590 ATGAGCCAGGAGGAGGGGGAAGG - Intronic
1078669156 11:13349744-13349766 TTTAACAAGGAGCTGAAGGACGG + Intronic
1079407002 11:20156404-20156426 GGGAACGAAGAGGAGGAGGAGGG - Exonic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079588554 11:22154933-22154955 TTTAGCAAGAAGGATGAGGAAGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079929944 11:26545790-26545812 TAGAGCAAGGAGGAAGAGGGAGG - Intronic
1079939817 11:26665557-26665579 TTGAAAAAGGAATTGGAGGATGG + Intergenic
1080048734 11:27836694-27836716 TAGGACAATGAGGAGGAGGGTGG + Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1080907725 11:36563313-36563335 TAGAACAAAGAAGTGGAGGAAGG + Intronic
1081548722 11:44092762-44092784 TAGGCCAAGGAGGAGAAGGAAGG + Intergenic
1081971375 11:47201187-47201209 TTGATCGAGGGGGAGGGGGAGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082181038 11:49119974-49119996 TTGAACAAATGGGAAGAGGAAGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1083310325 11:61780560-61780582 TGGAACATGGGGTAGGAGGAAGG + Intronic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1083788890 11:64971473-64971495 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1084128109 11:67114414-67114436 ATGAACATGGAGGAGGGGGTGGG + Intergenic
1084165790 11:67374105-67374127 TTACTCAAGGGGGAGGAGGAGGG - Intronic
1084214423 11:67639827-67639849 TTGAAGAGGGAGGACAAGGAGGG - Intergenic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084629125 11:70334241-70334263 TTTAACAAGTAGGTGGAGAAAGG + Intronic
1084967673 11:72752829-72752851 TTGAAGAATGTGGTGGAGGAAGG - Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1086684451 11:89714899-89714921 TTGAACAAATGGGAAGAGGAAGG - Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086853025 11:91833526-91833548 TGGAAGAAGGGAGAGGAGGAGGG + Intergenic
1086926242 11:92643556-92643578 TCCAACAAGGAGGATGATGAGGG + Intronic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087438832 11:98157613-98157635 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1088689696 11:112315226-112315248 ATGAACATAGAGGAGGAGGCAGG + Intergenic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089774900 11:120829230-120829252 CTTAACAAGGAGGTGGAGGGAGG - Intronic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091296417 11:134477008-134477030 TAGGACAGAGAGGAGGAGGAGGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091468101 12:703207-703229 TTGAAAAATGCGTAGGAGGAAGG + Intergenic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092164920 12:6336734-6336756 TTGAACTGGGAGGAGGAGCTGGG - Intronic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092662193 12:10750495-10750517 TTGAAAATTGGGGAGGAGGAAGG - Intergenic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093363902 12:18268989-18269011 TTGACCCAGGAGGTGGAGGTTGG - Intronic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093486190 12:19655716-19655738 TGGCAGAAGGAGGAGGAGTAAGG - Intronic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093813203 12:23511963-23511985 ATGAACAAGGAGGTTGAAGAAGG - Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1094609166 12:31976773-31976795 CTTAACTAGGCGGAGGAGGAGGG + Intronic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095341009 12:41088252-41088274 TAGAACAAAGAGGTAGAGGAAGG - Intergenic
1095537063 12:43261698-43261720 ATATACAAGGAGGAAGAGGAAGG + Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095729198 12:45487689-45487711 TAGAACAAAAAGGTGGAGGAGGG - Intergenic
1095732455 12:45521002-45521024 TGGAACAAAAAGGAAGAGGAAGG - Intergenic
1095927210 12:47591140-47591162 ATGAGCAAGGAGGAAAAGGAAGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097124242 12:56760809-56760831 TTGGACATGGGGGATGAGGAAGG + Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1097964422 12:65563607-65563629 GAGGACGAGGAGGAGGAGGAGGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098065714 12:66614092-66614114 CTGAAAAAGGAAGAGGAGAAAGG - Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099015692 12:77341477-77341499 TTGAACCAGGAGACGGAGGTTGG - Intergenic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099069923 12:78033466-78033488 TTATACAAGGAAGAGGAGGAAGG - Intronic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099588470 12:84553509-84553531 TTGCGCAAGGAGGAAAAGGAGGG - Intergenic
1099785099 12:87252269-87252291 TAAAACAAAGAGGAGGAGAAAGG - Intergenic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100126977 12:91439046-91439068 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1101407121 12:104438522-104438544 TTGAACATGGTCGAGGAGGTGGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101997367 12:109534666-109534688 TTGAAGCAGGTGGAGGAGGTGGG - Exonic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102687490 12:114735999-114736021 TTGTACAAGGAGGCTGAGGGTGG + Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102893914 12:116583060-116583082 TCAAAGAAGGAGGAGGAGGGTGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103296939 12:119895720-119895742 TTAATAAAGGTGGAGGAGGAAGG + Intergenic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103838197 12:123841000-123841022 TGGAACGTGGAGGAGGCGGAAGG - Intronic
1104083999 12:125458037-125458059 TTGAAGAAGGAGGCAGAGGGTGG + Intronic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105308268 13:19184075-19184097 TGGCACAAAGAGGAGGAGCAGGG + Intronic
1105492274 13:20900690-20900712 TTGAACCAGGAGGCAGAGGTTGG - Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105538010 13:21287813-21287835 TTGAATAAGGAGGAGCAGCGAGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106744052 13:32680691-32680713 TAAAACAAGGAAGAGAAGGAAGG - Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1106823022 13:33487636-33487658 TTGAACAAGGAAGATTATGAAGG - Intergenic
1106844859 13:33727650-33727672 TTGACCAAGAAAGAGGAGGTTGG - Intergenic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107111252 13:36700399-36700421 TTGAAACGGGAGGAGGAGGGAGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107423084 13:40267936-40267958 GTGAACATGGAGGAGGAAGTGGG + Intergenic
1107480122 13:40779309-40779331 TTGAAGCAGGAGGAGGAGTTAGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107718820 13:43227106-43227128 TAGAACAAGTCAGAGGAGGATGG + Intronic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1107980263 13:45728205-45728227 TGGAACATGGAGGAGCAGCAAGG + Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108345257 13:49539544-49539566 GTTAACAAGGAGGAGGAGCGTGG + Intronic
1108372938 13:49788942-49788964 TTGAAGGAGGAGGAAGAGGGAGG + Intronic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108731945 13:53244551-53244573 TGGGGCAAGGAGGAGGAGAACGG - Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110664168 13:78096397-78096419 TAGAACAAAAAGGAGAAGGAAGG + Intergenic
1110975479 13:81828564-81828586 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112484754 13:99810360-99810382 TTGAACTAGGAGCTGAAGGATGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113081339 13:106523470-106523492 TTGGACAAGGAGGAGGAAGGAGG + Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1113533064 13:111043460-111043482 TTGAACGTGGAGCAGAAGGAAGG - Intergenic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114076398 14:19163558-19163580 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1114085771 14:19236011-19236033 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1115006701 14:28494329-28494351 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116521152 14:45848660-45848682 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116898435 14:50339496-50339518 TTGAAGAAGGAAGAGAGGGAGGG + Intronic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1116999317 14:51356045-51356067 TGGAACCAGGAGAAGGACGAGGG + Intergenic
1117077169 14:52116367-52116389 TTGAACAAAGGGGAGGGGGTGGG - Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117442643 14:55774277-55774299 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1117821440 14:59654122-59654144 TTCCACAAAGAAGAGGAGGAGGG + Intronic
1117927983 14:60805057-60805079 TTGAACATGGCAAAGGAGGAAGG - Intronic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118561462 14:67087860-67087882 TTAAAAAAAGAGGAAGAGGAAGG - Intronic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119210000 14:72824402-72824424 ATGAACAGGGAGGAGAAGGGGGG - Intronic
1119655202 14:76412537-76412559 GTTTGCAAGGAGGAGGAGGATGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121835984 14:97092830-97092852 TTGTACAAAGAGGAGCAGAACGG - Intergenic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1122100168 14:99402169-99402191 TTGGACAAGGTAGAGCAGGAGGG - Intronic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1123028469 14:105439583-105439605 TCCAACCAGGAGGAGGAGAAGGG - Intronic
1202897323 14_GL000194v1_random:17724-17746 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1123986460 15:25650572-25650594 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124679234 15:31715416-31715438 TTGAACTAAAAGGAGGGGGAAGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125045258 15:35237884-35237906 GAGGACGAGGAGGAGGAGGAAGG + Intronic
1125458461 15:39885409-39885431 TAGAGCAAGGAGGTGGGGGATGG - Intronic
1125511222 15:40293449-40293471 TGGGAAGAGGAGGAGGAGGAAGG + Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1125929946 15:43593492-43593514 TAGAACCAGGAAGAGGAGCAAGG - Intronic
1125943114 15:43693324-43693346 TAGAACCAGGAAGAGGAGCAAGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126386066 15:48094644-48094666 TTGAAAAAGGAGGACCAGGCTGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1128056715 15:64705014-64705036 TTGAACCTGGAGGAGTAGGTAGG - Intergenic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128388751 15:67168652-67168674 AGGCACAAGGAGGAAGAGGAGGG - Intronic
1128527721 15:68423793-68423815 ATCAACAAGAAGGAGGAGGCCGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129145881 15:73646805-73646827 TTTATCATGGAGGAGGGGGAGGG + Intergenic
1129200005 15:73993037-73993059 GTGATCAAGGTGGAGTAGGAAGG + Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130532802 15:84760298-84760320 ATGAACAAGAAGGAAGAGAAAGG - Intronic
1130744361 15:86635262-86635284 GGGAAGGAGGAGGAGGAGGAGGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131386818 15:92014852-92014874 TTGAGGGAGGTGGAGGAGGAGGG + Intronic
1131387072 15:92016772-92016794 TCATAAAAGGAGGAGGAGGAGGG + Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1132857800 16:2054776-2054798 TGGAGAAAGGAGGAGGAAGACGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133659999 16:7907083-7907105 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133695160 16:8256252-8256274 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1133982049 16:10640148-10640170 TGTCACACGGAGGAGGAGGAGGG - Intronic
1134256194 16:12613606-12613628 TTTAACAAAGAGGTGGTGGAAGG - Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134776672 16:16859372-16859394 TTGACCAATTAGGAGGAGAAAGG + Intergenic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135272665 16:21082746-21082768 TTGAACCGGGAGGTGGAGGCAGG + Intronic
1135529686 16:23242337-23242359 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1135534111 16:23279432-23279454 TTACACAAGGAGGAGGGTGAGGG + Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136461092 16:30410566-30410588 TGGCACATGGAGGAGGAGGAAGG + Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136922416 16:34343993-34344015 TTGGTCAGGGAAGAGGAGGAGGG - Intergenic
1136982157 16:35067813-35067835 TTGGTCAGGGAAGAGGAGGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137616552 16:49851573-49851595 TTAACAGAGGAGGAGGAGGAGGG - Intronic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1138318620 16:56091712-56091734 TTGAACAGGGAGAAGGAAGGAGG - Intergenic
1138674335 16:58640160-58640182 TTAAACAAGGCGGTGGAGGGGGG + Intergenic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142193791 16:88730111-88730133 TTCAACAAGGAAGAGCTGGAGGG + Intronic
1142328117 16:89431636-89431658 TTGAGGGAGGAGGTGGAGGAAGG - Intronic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1142799278 17:2335330-2335352 TGGATCAAGGAGGAACAGGATGG + Exonic
1142902434 17:3020399-3020421 TAGACCAGGGAGGAGGATGAGGG + Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143105514 17:4528555-4528577 TTGAACCTGGTGGTGGAGGAGGG - Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143389647 17:6552693-6552715 TTGAACAAAGGCTAGGAGGATGG - Intronic
1143432179 17:6895252-6895274 TTGAAAAAGGAGGGGGATGGAGG + Intronic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144039801 17:11400432-11400454 TAGAACAAGGATGAGGGGCAAGG - Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145094281 17:20010460-20010482 TTGAAGATGGGGGAGGAGGGAGG + Intronic
1145211642 17:21017627-21017649 TAGACCATGGAGGAAGAGGAAGG + Intronic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146664059 17:34685185-34685207 TCCAAGAAGGAGGGGGAGGAGGG - Intergenic
1146876714 17:36419467-36419489 TTGAACCAGGAGGTAGAGGTTGG - Intronic
1147062670 17:37893393-37893415 TTGAACCAGGAGGTAGAGGTTGG + Intergenic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147797983 17:43059381-43059403 TTGAACCGGGAGGCGGAGGTTGG + Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1148848280 17:50541613-50541635 TTGACCAAGGAGGAAGCTGAGGG - Exonic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1151329054 17:73396171-73396193 TCAAACAAGAAGGAGGAGGCTGG - Intronic
1151561005 17:74869521-74869543 GTGAACAAAGAGGAAGAGAATGG - Intronic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1152188540 17:78874113-78874135 TGGAAGGAGGAGGAGGAGGCTGG - Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153301973 18:3599204-3599226 TCAACCAACGAGGAGGAGGATGG - Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153365092 18:4247072-4247094 TAGGACAAGGAGGAGAAGGAAGG + Intronic
1153810951 18:8751003-8751025 TGCTCCAAGGAGGAGGAGGATGG + Intronic
1153994949 18:10432671-10432693 TGGCACAGGGAGGATGAGGATGG - Intergenic
1155050949 18:22147281-22147303 TTGTACAATGAGGAGGAGAAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155342784 18:24829863-24829885 TGGAACACAGAGGAGGAGGGAGG + Intergenic
1156515720 18:37678476-37678498 GTGAACAATGATGAGGAGAAAGG + Intergenic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1156959744 18:43011208-43011230 GTGATCAAGGAGGAGCAGGAAGG + Intronic
1157052832 18:44188468-44188490 TGGAGCAAGGAGGAGTAGAAAGG - Intergenic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158979665 18:62747522-62747544 TTGAAGAAGGAAGCGAAGGAAGG - Intronic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159611440 18:70530261-70530283 TAGAACAATGAGGCAGAGGAAGG - Intergenic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1159843623 18:73430969-73430991 GTGGGCAAGGAGGAGAAGGAAGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160425494 18:78776230-78776252 TGGAAAAATGTGGAGGAGGAAGG + Intergenic
1161241522 19:3225899-3225921 GTGGACAGGGAGGAGGAGGGAGG + Intronic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161865546 19:6829671-6829693 TTGGCCAAGGAGGAGGAGAAGGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163443418 19:17333242-17333264 GTGAAGAAGGCGGAGGAGGTGGG + Intronic
1163478942 19:17543179-17543201 TGGGACAAGGAGGAGGAGGTTGG + Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164808441 19:31137334-31137356 TAGAACAAAAAGGTGGAGGACGG + Intergenic
1164886194 19:31780543-31780565 ATGAACGGGGAAGAGGAGGAGGG + Intergenic
1165660247 19:37572400-37572422 TTGAGCAAGATGGAGTAGGATGG - Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165838225 19:38772025-38772047 TGGAACCTGGAAGAGGAGGATGG + Exonic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166268722 19:41700757-41700779 TTGAGCCAAGAGGAGGAGCAAGG - Intronic
1166336545 19:42111715-42111737 TTGAGCCAGGAGGGTGAGGATGG - Intronic
1167139051 19:47636976-47636998 TTGACTAAGGAGGGGAAGGAGGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167295557 19:48646893-48646915 GTGAAGGAGGAGGGGGAGGAGGG + Intergenic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
925236140 2:2279372-2279394 TTCAACATGGAAGAGGAAGAAGG + Intronic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925906165 2:8540705-8540727 GGGAACAAGGAGGTTGAGGAAGG + Intergenic
925960214 2:9006854-9006876 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926580016 2:14624811-14624833 TTAAGTAAGGAGGAGGAGGTAGG + Intergenic
926591866 2:14749124-14749146 TTGGACAAGCAGGAGAAGGTTGG + Intergenic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927023706 2:19043712-19043734 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
927628889 2:24753466-24753488 TTCAACAAGGAGTAGGAGTAGGG - Intronic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927753187 2:25688070-25688092 TTGAACAGGGAGGCGGAGGTTGG - Intergenic
927866204 2:26589262-26589284 GGAAAGAAGGAGGAGGAGGAAGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928266138 2:29813423-29813445 TGGATGGAGGAGGAGGAGGAGGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932301190 2:70668012-70668034 TAGAACAAAAAGGTGGAGGAAGG + Intronic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
932408965 2:71534060-71534082 TTTTACAGGGAGGAGGGGGAAGG + Intronic
932500282 2:72177193-72177215 GTGAACAAGGTGGAGGAATAGGG - Exonic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932736962 2:74261004-74261026 AGGAGCAAGGAGGAGGAAGAGGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935662030 2:105475133-105475155 CTGAACCAGGAGGAAGAGCAGGG + Intergenic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
936608370 2:113979194-113979216 TTCAACTAGGAGGAGGAGGTTGG + Intergenic
936659951 2:114531994-114532016 TAGAACAAAGAGGCTGAGGAAGG + Intronic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937454143 2:122026755-122026777 TAGAGCAAGAAGGTGGAGGAAGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
938197003 2:129337257-129337279 TTTAACCAGCAGGTGGAGGATGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940073471 2:149715473-149715495 GTGACCATGGAGGAGGAGGCTGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
940415652 2:153417074-153417096 TTGAACAAAGACCAAGAGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941250153 2:163151484-163151506 GTGAACAAGGAGGAGGATTTTGG - Intergenic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
941361332 2:164555154-164555176 GTCAGCAAGGAGGAGGAGAAAGG - Intronic
941776259 2:169396673-169396695 TGGAAGGAGGAGGAGGAGAAGGG + Intergenic
942043739 2:172087249-172087271 GGTAAGAAGGAGGAGGAGGAGGG - Intronic
942199454 2:173556371-173556393 TGCAAACAGGAGGAGGAGGAAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942270173 2:174266498-174266520 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945548478 2:211188558-211188580 TTTATCAAGGAGGAGAAAGAAGG + Intergenic
945639375 2:212404262-212404284 TTGAAGAAAGAGGAGGAAAAAGG - Intronic
945703614 2:213201645-213201667 ATAAAGAAGGAGGAGGAGGGGGG - Intergenic
946073439 2:217053832-217053854 TTGTACATGGGGGTGGAGGAGGG - Intergenic
946441056 2:219696391-219696413 TTGATCTAGGAAGAGGAGGCAGG - Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947198699 2:227595773-227595795 TTAACCATGGAGGAGGAGGTGGG - Intergenic
947235374 2:227935926-227935948 TTGCTTAAGGAGGAAGAGGAGGG + Intergenic
947771080 2:232670522-232670544 TTGAATCTGGAGGAGGAGGGTGG + Intronic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
948883564 2:240872158-240872180 GTGAACATGGAGGCGGAGGAGGG + Intronic
948883569 2:240872190-240872212 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948883593 2:240872347-240872369 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883613 2:240872472-240872494 GTGAACATGGAGGCGGAGGAGGG + Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169631324 20:7635643-7635665 TTTAAAAATGAGGAGGAGAATGG - Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170360841 20:15544399-15544421 TTGAACAGCTAGGATGAGGAGGG + Intronic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1170782422 20:19437808-19437830 GGGAACAGGGTGGAGGAGGATGG - Intronic
1171969548 20:31555262-31555284 TGGCACAGGGAGGAGGAGCAAGG - Intronic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172044493 20:32070883-32070905 ACGAAGAAAGAGGAGGAGGAGGG + Intronic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173244886 20:41329894-41329916 TTAAAGAAGGAGTAGGAAGAGGG - Intergenic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174629280 20:51942448-51942470 TTGAACATGGAGGCGGAGGTTGG - Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175100800 20:56577419-56577441 TGGAAGAACGTGGAGGAGGAAGG + Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175723246 20:61300284-61300306 TTGAAAAATGAGCAGGAGAAGGG + Intronic
1175764333 20:61582325-61582347 TTGAACAATAAGGAGGAGAGCGG - Intronic
1176028567 20:62999051-62999073 TTGAAGGAGGAGGAGGAGTGGGG + Intergenic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1176617008 21:9033713-9033735 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177390886 21:20470301-20470323 TAGAACAAAGAGGCAGAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177644234 21:23881699-23881721 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178035249 21:28575363-28575385 TGGAACAAAGAAGAGGAAGAAGG - Intergenic
1178349881 21:31865018-31865040 AAGAAGAAGGAGGAGGAGAAGGG - Intergenic
1178458373 21:32777269-32777291 ATGAACTAGGGGGTGGAGGATGG - Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178940009 21:36897734-36897756 AGGTACAAGGAGGAGAAGGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180109507 21:45641614-45641636 TTAGAAAAGGAGGAGGAGAAGGG - Intergenic
1180292203 22:10857182-10857204 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180495008 22:15886604-15886626 TTTACCATGGGGGAGGAGGAGGG + Intergenic
1180592941 22:16956215-16956237 GTGAACAAGAAGGGGGAGAATGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1180928063 22:19570098-19570120 TGGAGCAAGGTGGAGTAGGATGG + Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181759881 22:25050995-25051017 GTGAAAGAGGAGGAGCAGGACGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182062886 22:27410516-27410538 TGGACCAAGGAGCTGGAGGAGGG + Intergenic
1182394542 22:30025997-30026019 TTGAAGGCAGAGGAGGAGGATGG - Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183175846 22:36224172-36224194 CTGAACTAGGAAGAGGAGAATGG + Intergenic
1183237014 22:36626462-36626484 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184272951 22:43395286-43395308 TGGAACAAGCAGGAAGAAGAAGG - Intergenic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184932522 22:47691815-47691837 TAGAACAAGGAGGCAGAGAAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185089424 22:48757394-48757416 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1185089436 22:48757433-48757455 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950789995 3:15463977-15463999 TTGAAATAGGGAGAGGAGGAAGG - Intronic
951391146 3:22105691-22105713 TAGAACAAAAAGGTGGAGGAAGG - Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952962696 3:38602714-38602736 TTGACCAGGAAGGTGGAGGATGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
953916381 3:46923444-46923466 TGGGAGAAAGAGGAGGAGGAAGG + Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954561848 3:51563337-51563359 TTTAAAAAGGAGGAAGAAGATGG - Intronic
954876397 3:53805711-53805733 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954876425 3:53805811-53805833 GGGAAGATGGAGGAGGAGGAGGG - Intronic
954911375 3:54113689-54113711 TTGAAAGAGGAGGAGAAGGAGGG - Intergenic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955821785 3:62903867-62903889 TTAAACAATCAGGAGGAGAATGG - Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956519535 3:70088397-70088419 TATTACAAGGAAGAGGAGGAAGG + Intergenic
957041272 3:75337241-75337263 CTGAACCAGGAGGAGGGGAAGGG + Intergenic
957866829 3:86036418-86036440 TTTAGCAAGGGGGAGTAGGAAGG - Intronic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
958584087 3:96062809-96062831 GGGAAGTAGGAGGAGGAGGAAGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959221681 3:103529507-103529529 TAGAACAAAAAGGGGGAGGAAGG - Intergenic
959245982 3:103868602-103868624 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960162495 3:114365597-114365619 TGAAACAAGGAGGAGGATGTGGG + Intronic
960934453 3:122889017-122889039 TTGACAAAAGAGGAGGAGGGAGG - Intergenic
961046080 3:123708896-123708918 CTGAACCAGGAGGAGGGGAAGGG + Intronic
961112653 3:124298167-124298189 TGGAGCTAGGAGGAGGAAGATGG + Intronic
961516286 3:127439416-127439438 TTAAGCAAGGAGGAGGAGGAGGG + Intergenic
961596995 3:128025663-128025685 TTGAACCAGGAGGTGGAGGTTGG + Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963226329 3:142866232-142866254 TAGAACAAAAAGGTGGAGGAAGG + Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963360392 3:144265249-144265271 TGGAGCAAGGAAGAGGAAGAAGG - Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964508913 3:157427943-157427965 TAGAACAAAAAGGTGGAGGAAGG + Intronic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965496587 3:169405874-169405896 TTGAACAAGGGTAAGGAGAAGGG + Intronic
965755002 3:172016770-172016792 GTGAACAGAGAGGATGAGGAGGG - Intergenic
965924058 3:173956390-173956412 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966559211 3:181300141-181300163 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968446138 4:653276-653298 TTGACCAAGGAGGCAGAGAAAGG + Intronic
968625812 4:1626200-1626222 TTGGCCCAGGAGGAGGAGGTAGG + Intronic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969512203 4:7624899-7624921 GTGATCATGGAGGAGGAGGACGG + Intronic
969829546 4:9783302-9783324 GTGGACAACGACGAGGAGGAGGG + Exonic
970052755 4:11933753-11933775 TAGAACAAATAGGTGGAGGAGGG + Intergenic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971598085 4:28557262-28557284 TGAAACAAGGAGGCGGAGGTTGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971766277 4:30835824-30835846 TTAAAATGGGAGGAGGAGGAGGG + Intronic
972231369 4:37076078-37076100 TTGAAGAAGGAGCTGAAGGATGG - Intergenic
973300326 4:48575207-48575229 TTAAACAAGGATGAAGGGGATGG + Exonic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973803289 4:54499422-54499444 ATTAACTAGAAGGAGGAGGAGGG - Intergenic
973863844 4:55092129-55092151 TTAAACAAGGTAGACGAGGAAGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
974705951 4:65515875-65515897 TAGAACAAAAAGGAGGAGAAAGG + Intronic
975299246 4:72770432-72770454 GTGAACAAAGGGGAGGAAGAAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975366802 4:73539156-73539178 TTGAAAAGAGAGGAGGAGGCAGG - Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975912686 4:79286347-79286369 TTGAGCAATGAGGATGAGGTGGG + Intronic
976069505 4:81224972-81224994 TTGAAGATGGAGGAAGGGGAGGG - Intergenic
976551518 4:86401931-86401953 TAGAACATAGGGGAGGAGGAGGG - Intronic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
977094684 4:92725218-92725240 TTGAACTGGGAGGTGGAGGGAGG + Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979210849 4:118100199-118100221 TAGAACTAAGAGGTGGAGGAAGG + Intronic
979276964 4:118824826-118824848 GAGAACTAGGTGGAGGAGGAGGG + Intronic
979302791 4:119106697-119106719 TTTCACTAGGAGGAGAAGGATGG - Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980907596 4:138963311-138963333 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
980993755 4:139761429-139761451 TGGAGCAGGGAGGAGGAAGAAGG - Intronic
981010388 4:139919236-139919258 TTGAAGAAGGGGGAGGAAGGGGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981041900 4:140230866-140230888 TAGAACAAAAAGGAGGAGAAAGG - Intergenic
981084319 4:140667408-140667430 TTGAACAAGGAGGATGAAAATGG + Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
981430870 4:144658447-144658469 TTGAACCGGGAGGTGGAGGTTGG - Intronic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982542144 4:156687201-156687223 TTGAACAAGAAGGCAAAGGATGG + Intergenic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982635675 4:157893971-157893993 TCTAACAAGGAGGAGGAGGCAGG + Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983102293 4:163639781-163639803 TCTAATAAGGAGGAGGAGTAAGG + Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986599375 5:9456361-9456383 TTGACCAAGGAAGAGGAAGGAGG + Intronic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988906769 5:35798469-35798491 TTGACCAATGACGTGGAGGAGGG - Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
990001862 5:50902731-50902753 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990589753 5:57249974-57249996 TCAAACGAGGAGGAGGGGGAGGG - Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992035491 5:72770643-72770665 TTGAACAAGCACCAGTAGGAGGG - Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992450372 5:76870823-76870845 TTAAAAAATGAGGAGGAGGCTGG + Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993475371 5:88357866-88357888 TTGAACAAAAAGGCAGAGGATGG - Intergenic
993669332 5:90741142-90741164 TTCCACAGGGATGAGGAGGAAGG - Intronic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
996570792 5:124930526-124930548 TTAAACAAGAAGGAATAGGATGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996827971 5:127706882-127706904 TTGATCAAAGACGAGAAGGAAGG + Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997778038 5:136629175-136629197 TTGGCCAGGGAGGAGGAGAAGGG + Intergenic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998064570 5:139147637-139147659 TTGAACATGGACTTGGAGGAGGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998733278 5:145106033-145106055 ATGGACAAAGAGGTGGAGGAAGG - Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001897571 5:175394525-175394547 ATGAACAAAGAGGATAAGGAAGG - Intergenic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003473005 6:6454214-6454236 TAGAACAACAAGGTGGAGGAAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003656475 6:8015412-8015434 TTGAATGAAGAGGAGTAGGAAGG - Exonic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004534796 6:16490237-16490259 TGGAACCAGTAGGAGGAGAATGG - Intronic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005993791 6:30919903-30919925 GGGAACCAGGAGGAAGAGGAAGG + Intronic
1006234427 6:32616140-32616162 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006650191 6:35545037-35545059 GTGAAGCAAGAGGAGGAGGAGGG + Intergenic
1006805963 6:36789295-36789317 GGGAAGAAGGAGGAAGAGGAAGG + Intronic
1007564662 6:42840614-42840636 TTGAACTGGGAGGTGGAGGTTGG - Intronic
1007689130 6:43687451-43687473 CTTCACAAGGCGGAGGAGGACGG - Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008484574 6:52021775-52021797 TTATACAAAGAGGAGAAGGAGGG - Intronic
1008683880 6:53903206-53903228 TTGATCAAGGAGCCAGAGGATGG + Intronic
1008742848 6:54630697-54630719 TAGAACAAAAAGGAGTAGGAAGG + Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011704010 6:89983137-89983159 TTAAAGAAGGAGGCAGAGGATGG - Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1014344795 6:120254608-120254630 ATGAACAAAGAGGAGGAGATGGG + Intergenic
1014399299 6:120967212-120967234 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1014475359 6:121865518-121865540 TTAAAAAAGGAGGGAGAGGAAGG - Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014924270 6:127252877-127252899 TTGAACAAAAAGGTGGAAGAAGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015651528 6:135467002-135467024 TAATACAAGGAAGAGGAGGAGGG + Intronic
1015878083 6:137844451-137844473 TTGAAGAAAGAGGAGGAGTGTGG + Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016806775 6:148219631-148219653 TTGCCCCAGAAGGAGGAGGAAGG - Intergenic
1016846517 6:148573296-148573318 GTGAACAGGGAGGAGCAGTAAGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1017086985 6:150722646-150722668 TTAAAAAAGGAGGAAGAGGCAGG - Intronic
1017281164 6:152627575-152627597 TTGAACAGGGAGATGGAGGTTGG + Intronic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1017961930 6:159231013-159231035 TTAAACAAGAAGGAGGAAGCAGG + Intronic
1017982923 6:159417904-159417926 TTTAACAAGGAGGAAGAATAAGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018305207 6:162447815-162447837 TTGACCAATGACAAGGAGGATGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1019146166 6:169976790-169976812 GTGACCAGGGAGGAGGAGGGAGG - Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020383315 7:7569239-7569261 TTTAAGAATGAGGAGGAAGAGGG - Intronic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1021139440 7:17005847-17005869 TCCAAGAAGGAGGAGGAGAAGGG - Intergenic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022196083 7:28068708-28068730 TTAAAAAAGGAGGAGGACAAAGG + Intronic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1022942007 7:35250086-35250108 GTGCACAGAGAGGAGGAGGACGG + Exonic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023706146 7:42943690-42943712 TTGAACCAGGAGGAGGACCTAGG + Intronic
1023974938 7:45021730-45021752 TGAGACAGGGAGGAGGAGGAGGG + Intronic
1024109795 7:46133651-46133673 GTCAAAGAGGAGGAGGAGGAGGG - Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026534652 7:71229780-71229802 TCGAACTAGGTGGAGGCGGAGGG - Intronic
1026539184 7:71265527-71265549 TTGCACAAGGAGGGCAAGGAAGG + Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027933796 7:84576146-84576168 TTCAACATGGAAGAGGTGGAGGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028234904 7:88348587-88348609 TTTAACTAGAAGGAGGAAGAAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028382275 7:90212251-90212273 AGGAACCAAGAGGAGGAGGAGGG - Intronic
1028392210 7:90329512-90329534 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1028754695 7:94421772-94421794 TAGACCAAGGAGTAGGAGGTAGG - Intronic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030108750 7:106008821-106008843 AGGAACAAGGAAGAGCAGGAGGG - Intronic
1030497141 7:110314440-110314462 GTGAACAAGGAGGGGAAGGGAGG - Intergenic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030638251 7:111974556-111974578 TTGCAGAGAGAGGAGGAGGAAGG + Intronic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032491240 7:132326136-132326158 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1033735670 7:144219023-144219045 TTGGACAAAGAGGAGGCTGAAGG + Intergenic
1033747382 7:144331930-144331952 TTGGACAAAGAGGAGGCTGAAGG - Intergenic
1033858363 7:145593996-145594018 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034945447 7:155259051-155259073 GGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035426899 7:158784051-158784073 AGGCACAGGGAGGAGGAGGAGGG + Intronic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035530298 8:345829-345851 TAGAACACAGAGGTGGAGGAGGG + Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037450161 8:19008845-19008867 TGAAACAATGAGGAGGAGGATGG - Intronic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038483665 8:27918890-27918912 GGGAAGAAAGAGGAGGAGGAAGG + Intronic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039169670 8:34728700-34728722 TTTAACAAGGAGGTTGTGGAAGG + Intergenic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039479842 8:37864279-37864301 TTGAACCAGGAGGAGATGTAAGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040548728 8:48422317-48422339 TGGAGCCAGGAGGAGGAGGAGGG + Intergenic
1041119057 8:54568125-54568147 TAGAACAAGAAGGAGGAAAAGGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042388282 8:68202961-68202983 TGGAACAAAAAGGAAGAGGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044244429 8:89925501-89925523 TTGAAAGAGGAGGAGGAGATGGG + Exonic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044745277 8:95365032-95365054 TTGAGCAGGGAGGAGGAGGCAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047196980 8:122730521-122730543 TTCAAATAGGAGGAAGAGGAAGG - Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049286435 8:141777954-141777976 TGGAACCAGGAGGAGGAGGCTGG + Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049356717 8:142192779-142192801 TAGAACAGGGAGGAGCAGAAGGG + Intergenic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1049674019 8:143881826-143881848 TAGAAGACAGAGGAGGAGGAGGG + Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050234873 9:3566928-3566950 TTGAAGAAGGAAGAGGAGTGGGG + Intergenic
1050276575 9:4007378-4007400 TTGAACCAGGAAGAGGGAGAGGG - Intronic
1050334129 9:4574430-4574452 TTGAGCAAGTAGGAGCAGGATGG + Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051508117 9:17847333-17847355 TTGAACCAGGTGAAGGGGGAGGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1052305680 9:27006663-27006685 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1052417919 9:28201811-28201833 TTTAAATAGGGGGAGGAGGAAGG - Intronic
1052469021 9:28869428-28869450 ATGAACAAGGAGTGGGGGGAGGG + Intergenic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055283126 9:74697596-74697618 TTTAACCAGGAGGATGAAGAAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055759548 9:79591874-79591896 TGAAAGAAGGAAGAGGAGGAGGG + Intronic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1057377691 9:94540349-94540371 TGGAGCAAAGAGTAGGAGGACGG - Intergenic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058654367 9:107206457-107206479 TTGAAAAAGGTGGAACAGGATGG + Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058684078 9:107465663-107465685 TTCAACAGGGAGGAAGAGGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060495748 9:124117643-124117665 GTGAACAGGGAGGCTGAGGATGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062131413 9:134896002-134896024 TTGAACCAGGAGGAGAATGCAGG - Intergenic
1062203229 9:135320108-135320130 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1062394534 9:136347443-136347465 GTGAGCAGGGAGGAGGATGAGGG + Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186264559 X:7818532-7818554 TGCAAGAAGGAGGAGAAGGAGGG + Intergenic
1186402587 X:9273548-9273570 TTCTACAGGGAGGAAGAGGAAGG + Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1186529330 X:10279503-10279525 TTGAACAAAAAGGTGGAGAAAGG - Intergenic
1186828364 X:13364516-13364538 TTGAGCTAGGATGATGAGGATGG - Intergenic
1186894561 X:13992905-13992927 TTGGACTAGGAGGAGGTGGTGGG + Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025741 X:15433909-15433931 GGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187403976 X:18985329-18985351 TTAGTCAAGGAGGAGGAAGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188591783 X:31845624-31845646 TTGAACAAACAGGAGCAGCACGG + Intronic
1189073826 X:37894779-37894801 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1189193544 X:39132738-39132760 TTGAAGATGGAGGAAGAGGTAGG - Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189284456 X:39841459-39841481 TGGAAGAAGGAGGACCAGGAAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192590683 X:72357045-72357067 TTGAACCAGGAGAGGGTGGAAGG + Intronic
1193353876 X:80494029-80494051 TTGAACAAGGCCTAGGAGCAAGG + Intergenic
1193905027 X:87231820-87231842 ATGAGCAAGGATGAGGAGCAAGG + Intergenic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195689328 X:107610927-107610949 TTTAGCAAGGAGGATGAGGATGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1195766227 X:108298816-108298838 TTTATGAAGGAGGAGGAAGAGGG + Intronic
1196141258 X:112265795-112265817 TTATGCATGGAGGAGGAGGAAGG - Intergenic
1196239790 X:113329772-113329794 TTGAACAAAAAGGCAGAGGAAGG - Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1197281770 X:124545250-124545272 TCAAACCAGGAGGAGGAGAAGGG + Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198243127 X:134803716-134803738 TTGAGCAGGGAGTAGGAGGTGGG - Intronic
1198797679 X:140416304-140416326 TGAAACAAGGAGAAGGAGCAGGG - Intergenic
1198806552 X:140500671-140500693 TAAAACAAGGAAGAGGAGGGAGG + Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1198962301 X:142195522-142195544 TTGAGCAGGGATGGGGAGGATGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199492067 X:148411189-148411211 TTGAGCAAGGAGCCGAAGGAGGG - Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200006901 X:153091989-153092011 TTGAACAAAGAGCAGGGGGCAGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201150407 Y:11092564-11092586 TTTACCATGGGGGAGGAGGAGGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201577889 Y:15479504-15479526 TTGAACAGGGAGGTGGAGATTGG + Intergenic
1201738873 Y:17302399-17302421 TTGAGCAGGGAGGAGCAGAAGGG + Intergenic
1202305827 Y:23469559-23469581 TTGAACCCGGAGGCGGAGGTTGG - Intergenic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic
1202564982 Y:26201030-26201052 TTGAACCCGGAGGCGGAGGTTGG + Intergenic