ID: 1182469219

View in Genome Browser
Species Human (GRCh38)
Location 22:30537272-30537294
Sequence CAGTTTCAGTTTAGCGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182469219_1182469220 22 Left 1182469219 22:30537272-30537294 CCATGCTCGCTAAACTGAAACTG 0: 1
1: 0
2: 1
3: 4
4: 89
Right 1182469220 22:30537317-30537339 TCAAGAGAGATAGCCTAGCCAGG No data
1182469219_1182469221 27 Left 1182469219 22:30537272-30537294 CCATGCTCGCTAAACTGAAACTG 0: 1
1: 0
2: 1
3: 4
4: 89
Right 1182469221 22:30537322-30537344 AGAGATAGCCTAGCCAGGCACGG 0: 1
1: 0
2: 0
3: 34
4: 516
1182469219_1182469222 30 Left 1182469219 22:30537272-30537294 CCATGCTCGCTAAACTGAAACTG 0: 1
1: 0
2: 1
3: 4
4: 89
Right 1182469222 22:30537325-30537347 GATAGCCTAGCCAGGCACGGTGG 0: 1
1: 0
2: 5
3: 133
4: 1486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182469219 Original CRISPR CAGTTTCAGTTTAGCGAGCA TGG (reversed) Intronic
902369649 1:15997848-15997870 CAATTTCAGCTCAGCTAGCAGGG - Intergenic
902475641 1:16684346-16684368 CAGTTTCAGTTTGGCTAGTGAGG + Intergenic
906847221 1:49206247-49206269 CAGTCTCAGTTAAGGGAGCTAGG - Intronic
912546075 1:110452784-110452806 CAGTTACAGTCCAGGGAGCAGGG - Intronic
913440582 1:118893036-118893058 CAGTTTCAGCATGGCCAGCATGG + Intronic
919509907 1:198448839-198448861 GAGTTTCAGATAAGAGAGCAGGG + Intergenic
921596489 1:217059601-217059623 CAGTTCCACGTTAGCCAGCAGGG - Intronic
1063771519 10:9208159-9208181 ATGTTTAAGTTTAGCTAGCACGG - Intergenic
1064571504 10:16698274-16698296 CAGTTTCGGATGATCGAGCAAGG - Intronic
1066510253 10:36087591-36087613 CAGTATCAGCTAAGCCAGCAAGG + Intergenic
1067282781 10:44885547-44885569 CAGTTTCAGTTTTCTGAGCATGG + Intergenic
1068966144 10:62913854-62913876 CTGTTTCTGTTTAGGGAGAAGGG - Intronic
1069343374 10:67439107-67439129 CACTTTCATTTCTGCGAGCAGGG - Intronic
1070204783 10:74246702-74246724 CAGTTTGGGTTTGGTGAGCATGG + Intronic
1071212868 10:83364716-83364738 CAGTATCAGTTTAACCAGCGAGG - Intergenic
1072801054 10:98392741-98392763 CAGTCTCAGTTCAGTGACCAGGG + Intronic
1074016314 10:109537813-109537835 CAGTTTCAGTTTTCTGAACATGG + Intergenic
1081339727 11:41913265-41913287 CAGTTTCAGTTTTCTGAGTATGG + Intergenic
1085599330 11:77840717-77840739 CAGTTTCAGTTTACTGAGTGTGG + Intronic
1086350648 11:85940849-85940871 CAGTTTCAGTTTCCCGAATATGG - Intergenic
1087059209 11:93962101-93962123 CAGTTTGAGTTTGGACAGCATGG + Intergenic
1091395261 12:150478-150500 CAGTTTCAGGTCAGTGAGGAGGG + Intronic
1092688816 12:11084077-11084099 CAGGATCAGTTTAGATAGCACGG + Intronic
1096234971 12:49920314-49920336 CAGCTTAAGTTTAGGGAGTAAGG + Intergenic
1097398088 12:59100659-59100681 CAGGTTCAGTGTAGCAAGGAAGG + Intergenic
1097672907 12:62561647-62561669 CAAATTCAGATTAGCAAGCAAGG + Intronic
1100091242 12:90974096-90974118 CATTTTCTGTTTAGTGATCATGG + Intronic
1101599202 12:106193904-106193926 CAGTTTCACTTTGGCAAGTAAGG + Intergenic
1103463775 12:121125517-121125539 CAGTTGCAGGTAAGCAAGCAAGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1116176654 14:41479323-41479345 CACTCTCATTTTAGGGAGCAGGG + Intergenic
1118509812 14:66459692-66459714 CAGTCTCAGTTTAGCAAGGGAGG - Intergenic
1119463611 14:74833854-74833876 CAGGTTCAGTGTAAAGAGCATGG + Intronic
1127207530 15:56735754-56735776 CAGTTTCAGTTTTGTGAGCATGG + Intronic
1128004886 15:64229552-64229574 TGCTTTCAGTTTAGCGATCAGGG - Intronic
1134758094 16:16687132-16687154 CAGTTTCAGCTTTCCGAACATGG + Intergenic
1134987976 16:18672048-18672070 CAGTTTCAGCTTTCCGAACATGG - Intergenic
1144866663 17:18339959-18339981 CAGATTCAGTTGAGGGAGCTGGG - Intronic
1145123372 17:20280437-20280459 CAGTTTCAGTGTAGAGACCAAGG - Intronic
1147537787 17:41332236-41332258 CAATTTCAGCTTAGCTATCAGGG - Intergenic
1154084970 18:11294947-11294969 CTGTTTTAGTTTATCAAGCATGG + Intergenic
1155438661 18:25838850-25838872 CAGTCTCAGTTTATCCATCAAGG + Intergenic
1155940301 18:31795889-31795911 TAGTTTCTGTTTAGCCATCAGGG + Intergenic
1161832443 19:6616778-6616800 GAGTTCCACTTTAGCGAACACGG + Intergenic
925117678 2:1394326-1394348 CAGTTTCATTTTGACGACCATGG + Intronic
925730509 2:6917240-6917262 CATTTTCATGTTAGCGTGCACGG + Intergenic
930760326 2:55027876-55027898 CAGTTTGAGTATAGCCAGAAAGG - Intronic
942587122 2:177493187-177493209 CAGTTTCAGTTTGGTAAGTAAGG + Exonic
1174167488 20:48595481-48595503 GTGTGTGAGTTTAGCGAGCAGGG - Intergenic
1182469219 22:30537272-30537294 CAGTTTCAGTTTAGCGAGCATGG - Intronic
949440821 3:4078311-4078333 TAGTTTGAGTTTAGCAAGCTTGG - Intronic
949802524 3:7919319-7919341 CAGTTTCAGTTCATCGATAAGGG - Intergenic
950311943 3:11966556-11966578 CAGTTCCAGTTTAGCAACCCTGG + Intergenic
954848425 3:53579701-53579723 CAGTTACATCTTAGCAAGCAGGG + Intronic
960234672 3:115268027-115268049 CAGTTTCAGTTTTCCGTACATGG - Intergenic
961665237 3:128490139-128490161 CAGTTTCAGCGCAGCGAGCTCGG + Intronic
963752134 3:149192373-149192395 CATTTTCAGTTTGGTGAGTAGGG - Intronic
966057596 3:175714825-175714847 CAGTTTCAGTTTTTTGAACATGG - Intronic
966561012 3:181320452-181320474 CAGTTTCAGTTTACTGCACATGG + Intergenic
967820934 3:193838092-193838114 CAGTTTCAGTTTACTGAATATGG - Intergenic
981095848 4:140779500-140779522 TAGTTTCAGTTTAGCAGGGATGG + Intergenic
986418070 5:7548030-7548052 CAGTTTCAGCTTAACTTGCATGG - Intronic
987290931 5:16507409-16507431 CAGGTTCAGTTTTGAGATCATGG - Intronic
987502769 5:18734367-18734389 CAGTTTCAGTTCAGATAACAAGG + Intergenic
987813528 5:22870936-22870958 CAGTTTCTCTATAGTGAGCATGG - Intergenic
989236104 5:39150158-39150180 CAGTTTCAGTTTGGTGAGCGTGG - Intronic
990814617 5:59769134-59769156 CAGATTGAGTTTAGTAAGCAGGG - Intronic
992009388 5:72511667-72511689 CAGTGCTAGTTTAGAGAGCAAGG - Intergenic
995139136 5:108714738-108714760 TAGTTTCAGTTAAGTGATCAGGG - Intergenic
995740335 5:115349286-115349308 CAGTTTCATTTTAGCTAAAAAGG + Intergenic
996031204 5:118705847-118705869 TGGTTTCAGTTTAAGGAGCAGGG - Intergenic
996533349 5:124549619-124549641 CAGATTCAGTTTTGAGAGGATGG - Intergenic
998000270 5:138619691-138619713 AATTTTCATTTTGGCGAGCAAGG - Intronic
998322217 5:141243012-141243034 CAGTTTGAGTTTGGCCAACATGG - Intergenic
1000621692 5:163493621-163493643 CAGTTTGCTTTTAGCTAGCAAGG - Intergenic
1008539749 6:52536491-52536513 CTGTGACAGTTTAGCCAGCAGGG + Intronic
1016889174 6:148988686-148988708 CAGCTTCAGATTAGAGACCAGGG - Intronic
1020260953 7:6530645-6530667 CTGGTTCAGTATAGGGAGCACGG + Intronic
1022338463 7:29445834-29445856 CAGATTCAGTTTAGTCATCATGG + Intronic
1031252701 7:119408190-119408212 GAGTTTCAGTTTAGCTTGCATGG - Intergenic
1031578071 7:123439660-123439682 CAGCTTCAGTATCGCAAGCAGGG + Intergenic
1036189392 8:6656518-6656540 CAGTTTCTGTTTGGAGAGAATGG + Intergenic
1038541942 8:28397143-28397165 GAGTTTCAGTATAGATAGCAAGG + Intronic
1039006387 8:33042315-33042337 CCCTTTCAGTTGAGAGAGCAAGG + Intergenic
1044390898 8:91649718-91649740 CAGTTTCAGTTTTCTGAACATGG - Intergenic
1045660848 8:104436093-104436115 CAGCTTCAGTTTAAGGTGCAGGG - Intronic
1047795140 8:128247548-128247570 CAGCTTCATTTTAGAGAACAAGG - Intergenic
1048961612 8:139584224-139584246 TAGTTTCAGTCTGGCCAGCAAGG - Intergenic
1053148435 9:35727736-35727758 CAGTTTCAGCTTAGTGTGAAGGG - Intronic
1055462678 9:76533455-76533477 CAGTTTCAGATAAACAAGCATGG + Intergenic
1056084988 9:83138978-83139000 CAGTTTCTGCTTTGGGAGCAGGG + Intergenic
1057963359 9:99478593-99478615 GTGTTTCAGTTTACAGAGCACGG - Intergenic
1059538467 9:115106809-115106831 CACTTTCAGTTTTGAAAGCATGG + Intronic
1190239769 X:48648521-48648543 CAGTTTCTGGTTAGAGAGCTTGG + Intergenic
1197146192 X:123175351-123175373 CAATTTGAGTTTAGATAGCAGGG + Intergenic