ID: 1182470574

View in Genome Browser
Species Human (GRCh38)
Location 22:30545673-30545695
Sequence ATCCTCCCGCCTCAAAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 8, 2: 27, 3: 60, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182470571_1182470574 -9 Left 1182470571 22:30545659-30545681 CCTGGGCTCCAGTGATCCTCCCG 0: 44
1: 1655
2: 19433
3: 58458
4: 150663
Right 1182470574 22:30545673-30545695 ATCCTCCCGCCTCAAAGTGCGGG 0: 1
1: 8
2: 27
3: 60
4: 352
1182470570_1182470574 -1 Left 1182470570 22:30545651-30545673 CCAGAACTCCTGGGCTCCAGTGA 0: 13
1: 265
2: 1123
3: 2541
4: 4663
Right 1182470574 22:30545673-30545695 ATCCTCCCGCCTCAAAGTGCGGG 0: 1
1: 8
2: 27
3: 60
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182470574 Original CRISPR ATCCTCCCGCCTCAAAGTGC GGG Intronic
900474896 1:2871488-2871510 ATCCTTCCGCCTCATGGTGCAGG + Intergenic
900611319 1:3545747-3545769 ATCCTCCCTCCTCACTGAGCCGG + Intronic
900829672 1:4956908-4956930 AACCTCCCCCCTCAAAGCGGGGG + Intergenic
901139293 1:7018068-7018090 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
901418866 1:9136811-9136833 ATCCACCTGCCTCAAAGTGCTGG + Intergenic
901616653 1:10545463-10545485 ATTCTCCAGGCTCAAAATGCTGG - Intronic
902356655 1:15907018-15907040 GTCCTCCTGCCTCAAAGTAGTGG + Intronic
902426822 1:16330269-16330291 ATCTTGGCGTCTCAAAGTGCTGG - Intronic
903200878 1:21738002-21738024 ATCCTCCCACCTCAACCTCCAGG + Intronic
903295016 1:22338172-22338194 ATCCTCCCACCTCAACCTCCAGG - Intergenic
906361136 1:45160760-45160782 ATTCTCCTGCCTCAAACTCCTGG + Intronic
906449450 1:45932430-45932452 ATCCACCCACCTCAAAGTGCTGG - Intronic
908313861 1:62913246-62913268 ATCCTCCCACCTCAGACTCCAGG - Intergenic
908647597 1:66295668-66295690 ATCCTCCCATTTCAAAGTGCTGG + Intronic
912749475 1:112274063-112274085 ATCTGCCTGCCCCAAAGTGCTGG + Intergenic
913692286 1:121290572-121290594 ATCTTACCCTCTCAAAGTGCTGG - Intronic
914145269 1:144989542-144989564 ATCTTACCCTCTCAAAGTGCTGG + Intronic
914763054 1:150614600-150614622 ATCTTCCCCTCCCAAAGTGCTGG + Intronic
917308199 1:173649317-173649339 ATACTCCCTCCTCAGAGTGAAGG + Intronic
918513544 1:185337556-185337578 ATCCTCCCACCTCAACCTCCTGG - Intergenic
919121097 1:193341031-193341053 TGCCTCCACCCTCAAAGTGCTGG + Intergenic
919728127 1:200896866-200896888 ATCCTGCCTCCTCAGAGCGCGGG - Intronic
920196620 1:204231813-204231835 ATCCTCTTGTCCCAAAGTGCTGG + Intronic
920479610 1:206308921-206308943 ATCTTACCCTCTCAAAGTGCTGG - Intronic
922004533 1:221516410-221516432 TTCCTCCCCTCCCAAAGTGCTGG + Intergenic
922518414 1:226224879-226224901 ATCCACCCGCCTCAAAGTGCTGG + Intronic
922649206 1:227322378-227322400 ATCCTCCCGCCTCAAATGCTGGG + Intergenic
922926390 1:229350377-229350399 ATCCTCCCACCTCAACCTCCTGG - Intergenic
924532701 1:244906794-244906816 ATCCTCCTGCCTCAGACTCCTGG + Intergenic
924692686 1:246366692-246366714 ATCCGCCCACCTCAAAGTGCTGG - Intronic
924699458 1:246436729-246436751 ATGCTCCCGCCCCCAAGGGCAGG + Intronic
1064195539 10:13241190-13241212 ATCCTCCCGCCTCAACCTCTTGG - Intergenic
1064259469 10:13773751-13773773 ATCCTGCAGCCAGAAAGTGCGGG + Intronic
1065430208 10:25646219-25646241 ACCCTCGCCTCTCAAAGTGCTGG + Intergenic
1065913285 10:30329332-30329354 ATCCTCCAGCCTCAACCTTCAGG + Intronic
1066350223 10:34630553-34630575 ATCCTCCCACCTCAACCTCCTGG + Intronic
1066372808 10:34831596-34831618 ATTCGCCCACCTCAAAGTGCTGG + Intergenic
1066478755 10:35774389-35774411 ATCCTCCCACCTCAACCTCCAGG + Intergenic
1067530419 10:47067176-47067198 ATCCGCCCTCCCAAAAGTGCTGG + Intergenic
1067770274 10:49117451-49117473 AACCTCCCACCTCAACCTGCTGG + Intergenic
1067827249 10:49585940-49585962 ATCCCCCTGACTCAAAGTGCTGG - Intergenic
1068125018 10:52828300-52828322 ATCATCCCTCCTCCAACTGCAGG + Intergenic
1068263581 10:54617671-54617693 ATCCTCCCACCTCGAATTACAGG - Intronic
1068871936 10:61954763-61954785 ATCCACCTGCCTTGAAGTGCTGG - Intronic
1069462209 10:68606115-68606137 ATCCTGGCCTCTCAAAGTGCTGG - Intronic
1069932105 10:71889777-71889799 ATCCTCCTGCCTCAGCCTGCAGG - Intergenic
1069970833 10:72167709-72167731 ATCCTGCAGCCTCAAACTCCTGG + Intronic
1070040075 10:72769093-72769115 ATCCTCCCTCCTCAAAGCACTGG + Intronic
1073793626 10:106964408-106964430 ATCCTCCTGCCTCAGTGTCCTGG + Intronic
1074097191 10:110324388-110324410 ATTCTCCTGCCTCAAACTTCTGG + Intergenic
1075369090 10:121919664-121919686 ATCTACCCACCTCAAAGTGCTGG - Intronic
1075766826 10:124899743-124899765 ATCCTCCCACCTCAACATCCAGG - Intergenic
1076637073 10:131888774-131888796 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1076644947 10:131946827-131946849 ATCCTCCCGCCTCAACCTCCAGG - Intronic
1077535922 11:3124017-3124039 CTCCTCCCGCCTCTGCGTGCTGG - Intronic
1077587723 11:3466723-3466745 ATCCTGGCCTCTCAAAGTGCTGG - Intergenic
1077998882 11:7476877-7476899 ATCCTCCCACCTCAACCTCCAGG - Intergenic
1078312695 11:10261307-10261329 ATCCTCCCGTCTCAACTTACCGG + Intronic
1078769384 11:14333877-14333899 CACCTCCCTCCACAAAGTGCTGG + Intronic
1078879292 11:15432312-15432334 ATCCAGCCACCTCAAAATGCTGG - Intergenic
1079202939 11:18390983-18391005 ATCCTCCCACCTCAACCTCCTGG + Intergenic
1080323434 11:31042236-31042258 ATCCTCTCTCCTCAAATTGCAGG - Intronic
1080335248 11:31188069-31188091 ATCCTCCTGCCTCAAATAGCTGG + Intronic
1081027365 11:38032511-38032533 ATCCTCCCACTTCAATGTCCTGG - Intergenic
1081924446 11:46812895-46812917 AGCCTCCCAACCCAAAGTGCTGG + Intronic
1081952331 11:47055045-47055067 ATCCTCCCACCTCAAGTAGCTGG + Intronic
1081985560 11:47300453-47300475 CCCCGCCCGCCCCAAAGTGCTGG + Intronic
1082061203 11:47861681-47861703 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1082275953 11:50221849-50221871 ATCCACCCGCCTCGAACTTCTGG + Intergenic
1083243078 11:61404160-61404182 ATGGTCCCTCCTCAAAGGGCTGG + Exonic
1083440166 11:62670990-62671012 ATCCTCCTGCCTCAACCTCCCGG - Intronic
1083459409 11:62800707-62800729 ATCCTCCCACCTCAGACTCCTGG + Intronic
1083482158 11:62956351-62956373 ATCCTCCCACCTCAACCTCCCGG + Intronic
1083775849 11:64894073-64894095 CCCCTCCCCCCTCCAAGTGCTGG + Intergenic
1084150220 11:67284680-67284702 ATCCTCCCGCCTCAGCCTCCCGG - Intronic
1084243431 11:67838391-67838413 ATCCTAGCCTCTCAAAGTGCTGG - Intergenic
1085358812 11:75866113-75866135 ATCCTCTCGCCTCAACTTCCCGG - Intronic
1085411613 11:76294297-76294319 ATCCTCCCACCTCTCAGTCCTGG - Intergenic
1087032738 11:93722217-93722239 ATCCTCCCACCTCAAGGTGCTGG - Intronic
1088486607 11:110346862-110346884 ATCTTGCCTTCTCAAAGTGCTGG + Intergenic
1088488628 11:110365695-110365717 ATCTTGCCCTCTCAAAGTGCTGG + Intergenic
1089481974 11:118813211-118813233 ATCCTCCCACCTCAGCGTCCCGG + Intergenic
1089512876 11:119011618-119011640 ATCCACCCGCCTCAGCCTGCTGG + Intronic
1089658767 11:119972062-119972084 ATCCTACCCCCACAAAGTGATGG + Intergenic
1089842358 11:121429229-121429251 ATCCTCCCACCTCAAGTAGCTGG + Intergenic
1090783113 11:130024939-130024961 CTCCGCCCCCCCCAAAGTGCTGG + Intergenic
1091212005 11:133869935-133869957 ATCCTCCCACCTCAGCCTGCTGG + Intergenic
1091452049 12:578565-578587 ATCTTGCACCCTCAAAGTGCTGG + Intronic
1091487336 12:902190-902212 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1091571889 12:1693780-1693802 TGCCTCACCCCTCAAAGTGCTGG + Intronic
1092097333 12:5853822-5853844 ATCCTCCCACCTCAGAGCACTGG - Intronic
1092250500 12:6892597-6892619 ATCCTCCCACCTCAACCTCCAGG - Intronic
1092339682 12:7664798-7664820 ATCCTCCCGCCTCACCTTCCTGG - Intronic
1092880813 12:12886517-12886539 ATCTTCCTGCCTCAAAGTCTGGG + Intergenic
1093177778 12:15932533-15932555 ATCCTCCCACCTCAAGTAGCTGG - Intronic
1093407120 12:18817976-18817998 ATCCTCCTGCCTCAACCTCCAGG - Intergenic
1093890636 12:24516147-24516169 ATCCTCCCACCTCAACCTCCCGG + Intergenic
1094217558 12:27960474-27960496 ATCCACCTGCCCCAAAGTGCTGG - Intronic
1094288677 12:28821341-28821363 ATCCTCCCACCTCAGAATCCTGG - Intergenic
1094318147 12:29154672-29154694 ATCCGCCTGCCTCAAAGTGCTGG + Intronic
1094625611 12:32121207-32121229 ATCCACCTGTCTCAGAGTGCTGG + Intronic
1097093349 12:56525326-56525348 ATTCTCCCGCCTCAACCTCCTGG + Intronic
1098087800 12:66866217-66866239 ATCCTGACCTCTCAAAGTGCTGG - Intergenic
1098266929 12:68730861-68730883 ATCCTCCCACCTCAACCTCCCGG - Intronic
1100975276 12:100115925-100115947 ATCCGCCTGCCTTAAAGTGCTGG - Intronic
1101149290 12:101869797-101869819 ATCTTCCTGCCTCAAAGTGCTGG + Intergenic
1101830326 12:108251836-108251858 ATCCTCCCAACTGGAAGTGCAGG + Intergenic
1102378956 12:112446970-112446992 ATCCTCCCGCCTCAGCCTCCCGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103420724 12:120780176-120780198 ATCCTGGCCTCTCAAAGTGCTGG + Intronic
1103687841 12:122746238-122746260 ATCCTCCCACCTCAGCCTGCTGG - Intergenic
1104316474 12:127707845-127707867 ATCCTCCTGCCTCAACCTCCGGG + Intergenic
1105995344 13:25665788-25665810 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
1106101297 13:26696678-26696700 ATCCTCCTGCCTCAAATCTCCGG + Intergenic
1106164060 13:27226467-27226489 ATCCGCCCGCCTGAAAGTGTTGG + Intergenic
1106252553 13:27993712-27993734 ATCCTCCCACTTCAAAGTGCTGG - Intergenic
1107502842 13:40998038-40998060 ATCCTCCCGCCTCAACCTCACGG - Intronic
1107535065 13:41321189-41321211 ATCCTCCTGCCTCAACATCCTGG - Intronic
1107562900 13:41573164-41573186 ATCTGCCCACCTCAAAGTGCTGG - Intronic
1112427947 13:99321550-99321572 ATCCATCTGCCTCAAAGTGCTGG + Intronic
1113466909 13:110519502-110519524 ATCCTCCCACTTCACAGAGCTGG - Intergenic
1113746941 13:112751824-112751846 ATTCTCCCGCCTCAGAGTGCTGG + Intronic
1114203106 14:20541508-20541530 ATCCTCCTGCCTCAAACTCCTGG + Intergenic
1115571106 14:34667356-34667378 ATCCTCCTGCCTCAGTGTCCTGG - Intergenic
1115771831 14:36671362-36671384 ATCCTCCCTCCTCCAAGTAAAGG - Intronic
1117360885 14:54972327-54972349 TGCCTCACCCCTCAAAGTGCTGG - Intronic
1117569084 14:57028497-57028519 ATGCTCCAGCCTCAAACTCCTGG + Intergenic
1118226378 14:63903568-63903590 ATCCTCCCACCTCAGACTCCTGG + Intronic
1118441114 14:65812562-65812584 ATCCTCCCGCCTCAGCCTCCCGG + Intergenic
1118482755 14:66183475-66183497 ATCCTTCTGCCTCAACTTGCTGG + Intergenic
1119001663 14:70887623-70887645 ACCCTCCTTCTTCAAAGTGCAGG - Intergenic
1119001962 14:70890518-70890540 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1119221640 14:72913132-72913154 ATCTGCCTGCCCCAAAGTGCTGG - Intergenic
1120519386 14:85508849-85508871 ATCCTCCTGCCTCAGCCTGCTGG - Intergenic
1121085447 14:91142707-91142729 AGCCTCCCAACCCAAAGTGCTGG - Intronic
1121313356 14:92946934-92946956 ATCCTCCTGCCTCCAAGTTCCGG - Intronic
1121761083 14:96445551-96445573 ATCCTCCCGCCTCCACCTCCCGG - Intronic
1121931299 14:97974963-97974985 ATCCTCTCCCCGCAAAGTTCAGG - Intronic
1122565774 14:102654615-102654637 ATCTTCGCCTCTCAAAGTGCTGG - Intronic
1123957062 15:25347591-25347613 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1124207257 15:27732249-27732271 ATCTTCCCTTCTCAAAGTGGAGG + Intergenic
1125561635 15:40638423-40638445 ATCCTCCTGCCTCAACCTCCTGG + Intronic
1126759562 15:51956930-51956952 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
1129505767 15:76080258-76080280 ATCCTCCCACCTCAGACTCCTGG - Intronic
1129700975 15:77768607-77768629 TTCCTCCCTCCTCCAAGTCCAGG - Intronic
1130120219 15:81041549-81041571 ATCCTCCCATCCCAAAGTGCTGG + Intronic
1132352993 15:101151770-101151792 ATCCTCCCGCCTCAGCCTCCCGG - Intergenic
1133226392 16:4342715-4342737 ATCCGCCTGCCTCAAAGTGCTGG - Intronic
1133627749 16:7587935-7587957 ATCCACCCACCTCAAAGTGCTGG - Intronic
1134143117 16:11739454-11739476 ATGCTGCAGCCTCAAACTGCTGG - Intronic
1134601898 16:15540047-15540069 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1135046817 16:19162643-19162665 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1135068023 16:19327383-19327405 ATTCTCCCACCTCAAATTACAGG + Intergenic
1135104927 16:19640987-19641009 ATCCATCCACCTCAAAGTGCTGG + Intronic
1135352388 16:21739949-21739971 ATCCTCCCACCTCAGCCTGCTGG + Intronic
1135450876 16:22556071-22556093 ATCCTCCCACCTCAGCCTGCTGG + Intergenic
1136094465 16:27945114-27945136 ATCCTCCCACCTCCAAGAGACGG - Intronic
1136281878 16:29218120-29218142 TTCTGCCCGCCTCAAAGTGCCGG - Intergenic
1136571175 16:31097829-31097851 ACCTTCCCACCTCAAAGTGCTGG + Intergenic
1137529703 16:49270955-49270977 ATCTACCTGCCTCAAAGTGCTGG - Intergenic
1138644399 16:58413232-58413254 ATCCTCCTGCCTCAACCTCCAGG + Intergenic
1138725602 16:59135330-59135352 ATCCTCCCACCTCAACCTACAGG - Intergenic
1140756745 16:78074498-78074520 ATCCTGGCCCCCCAAAGTGCTGG + Intergenic
1141866900 16:86756600-86756622 ATCCTCCCGCCTCAGTCTCCAGG + Intergenic
1141955337 16:87367062-87367084 ATCCTCCCACATCAAACTGCCGG - Intronic
1141986968 16:87586355-87586377 ATTCTCCCGCCCCTGAGTGCGGG - Intergenic
1142086252 16:88184036-88184058 TTCTGCCCGCCTCAAAGTGCCGG - Intergenic
1142327308 16:89424198-89424220 ATCTGCCTGACTCAAAGTGCTGG - Intronic
1142662991 17:1444238-1444260 ATCCTCCTGCCTCAGACTCCTGG + Intronic
1143240212 17:5437558-5437580 ATCTGCCCGTCCCAAAGTGCTGG + Intronic
1144085924 17:11808323-11808345 CTCATCCAGCCTCCAAGTGCTGG - Intronic
1144887199 17:18471457-18471479 ATCATCCCGCCTGGAAGTGAAGG + Intergenic
1145145017 17:20472838-20472860 ATCATCCCGCCTGGAAGTGAAGG - Intergenic
1145215189 17:21045907-21045929 ATCCTCCCGCCTCAGCCTGCTGG - Intergenic
1145844924 17:28030392-28030414 ATCCTCCTGTCCCAAAGTACTGG + Intergenic
1146110657 17:30086100-30086122 ATCCTCCTGCCTCAACCTCCGGG + Intronic
1147789609 17:43005506-43005528 GTCCTCCTGCCTCAACCTGCTGG + Intergenic
1147802513 17:43102894-43102916 ATCCTCAAGCCTCCTAGTGCTGG + Intronic
1148143546 17:45345202-45345224 ATCTTGGCCCCTCAAAGTGCTGG + Intergenic
1148190148 17:45672571-45672593 ATCCCGCCGCCTCCACGTGCTGG - Intergenic
1148334154 17:46830493-46830515 ATCCTCCCCTCTCAAAGGGCTGG + Intronic
1148621008 17:49034616-49034638 ATCCTCCCACTTCAACCTGCTGG - Intronic
1148792926 17:50183711-50183733 ATCCCACCGCCACCAAGTGCAGG + Exonic
1149801960 17:59577692-59577714 ATCCTCCCGCCTCAGTCTCCTGG + Intronic
1149844530 17:59997789-59997811 ATCCTCCCGCCTCAGTCTCCTGG - Intergenic
1150150768 17:62807654-62807676 ATCCTCCCGCCTCAGCCTCCCGG - Intronic
1150821356 17:68436753-68436775 ATCCGCCCGCCTCAAAGTGCTGG - Intronic
1151361777 17:73593381-73593403 ATCCTTCCTCCTCATTGTGCAGG + Intronic
1153223737 18:2882501-2882523 ATCCCCCAACCTCAAAGTGCTGG - Intronic
1153728967 18:7987927-7987949 TGCCTCCCCTCTCAAAGTGCTGG - Intronic
1154092534 18:11378777-11378799 ATCTTGTCCCCTCAAAGTGCTGG + Intergenic
1154153526 18:11926258-11926280 ATCCTCCTGCCTCAGCCTGCCGG - Intergenic
1155304556 18:24466217-24466239 ATCCTCCTGCCTCAACCTCCTGG + Intronic
1155965405 18:32030941-32030963 ATCCTCCTGCCTCAGAGAGTTGG + Intronic
1156835262 18:41545875-41545897 ATCCTCCTGCCTCAATCTGTAGG + Intergenic
1157622029 18:49022260-49022282 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1157731359 18:50007079-50007101 ATCCTCCCTCCTCAAACACCAGG + Intronic
1159662399 18:71114818-71114840 ATCGGCTCACCTCAAAGTGCTGG + Intergenic
1159784546 18:72697457-72697479 ATCCTGCCCTCCCAAAGTGCTGG - Intergenic
1161123269 19:2541806-2541828 ATCCTCCCGCCTCAGCCTCCCGG - Intronic
1161197579 19:2995513-2995535 AACCCCCGACCTCAAAGTGCTGG - Intergenic
1161930417 19:7336069-7336091 ATTCTCCCGCCTCAAACTCCTGG - Intergenic
1162308086 19:9887789-9887811 ATCCTCTGGCCTCAAAATACTGG - Intronic
1162431010 19:10628444-10628466 ATCCTCCCACCTCAGCCTGCTGG - Intronic
1162827245 19:13260753-13260775 ATCCTCCCGCCTCAGCCTCCCGG + Intronic
1163011878 19:14431799-14431821 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1163027419 19:14520331-14520353 ATCCTCCCGCCTCAGGAGGCAGG - Intronic
1163287946 19:16360498-16360520 ATCCTCCCACCTTGAAGTACTGG - Intronic
1163555681 19:17991342-17991364 ATCCTCCCACCTCAACCTCCTGG - Intronic
1164175563 19:22771178-22771200 ATCCACCCGCCTTAAAGTGCTGG + Intronic
1164948058 19:32312705-32312727 ATCCACCCCCCGCAAAGTGCTGG - Intergenic
1166123043 19:40697216-40697238 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
1166555498 19:43697132-43697154 ATCCTCCTGTCCCAAAGTGCTGG + Intergenic
1166568389 19:43778950-43778972 ATCCTCCTGCCTCAAAGTGCTGG - Intronic
1166575299 19:43831733-43831755 ATCCTCCCACCTCAGAGGGAAGG + Intronic
1167862447 19:52296806-52296828 ATCCTCCCGCCTCAGTCTTCGGG + Intergenic
1167964159 19:53129813-53129835 CTCCTTCAGCCTCGAAGTGCTGG - Intronic
1168161621 19:54513931-54513953 ATCCTCCCCTCCCAAAGTGCTGG + Intergenic
1168537194 19:57180848-57180870 ATCCTCCCACCTCAGCCTGCAGG - Intergenic
1168577599 19:57526317-57526339 ATTCGCCTGCCTTAAAGTGCTGG - Intergenic
1168635771 19:57995576-57995598 ATCTGCCTGCCTCAAAGTGCTGG - Intronic
1168699424 19:58427760-58427782 ATCCTCCTGCCTCAAGTAGCTGG + Intergenic
926861046 2:17309186-17309208 ATCCCCCAGCCCCAAAGTGTGGG + Intergenic
928673208 2:33623489-33623511 ATCCTGCTGCCTCAAAGTGCTGG + Intergenic
929112142 2:38413900-38413922 ATCCTCCTGCCCCAAAGTGCTGG + Intergenic
931072035 2:58662646-58662668 ATCCTCCCACCTCAAGTAGCTGG - Intergenic
931375275 2:61701609-61701631 ATACGCCCGCCTCAAAGTGCTGG + Intergenic
932186429 2:69700273-69700295 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
934092574 2:88565581-88565603 ATCCACCTGTCCCAAAGTGCTGG + Intronic
934664754 2:96162732-96162754 ATCCTCCCACCTCAACCTCCTGG + Intergenic
935165901 2:100568387-100568409 ATCTGCCCATCTCAAAGTGCTGG - Intronic
937131449 2:119517264-119517286 TTCCTCCCGCCTCAACCTCCTGG + Intronic
938383865 2:130851151-130851173 AACCACCCTTCTCAAAGTGCAGG - Intronic
939464842 2:142544064-142544086 ATCCTTAGACCTCAAAGTGCTGG + Intergenic
941795559 2:169595167-169595189 GTCCACCCGCCTCAGAGTGCTGG + Intronic
941988511 2:171531556-171531578 TTCCACCCCTCTCAAAGTGCTGG + Intronic
942026894 2:171919628-171919650 AGCCTCCAGCCTCCAACTGCTGG - Intronic
942255544 2:174093359-174093381 ATCCTCCCACCTCAACCTCCTGG - Intronic
942282878 2:174384664-174384686 ATCCTCCTGCCACAAAGTGTTGG + Intronic
942414350 2:175742968-175742990 ATCCTCCAGCCCCTAAATGCCGG + Intergenic
943381292 2:187152329-187152351 ATCCTCCCACCTCAACCTCCTGG + Intergenic
944624086 2:201552222-201552244 ATCCTCTCCTCCCAAAGTGCTGG + Intronic
945139082 2:206664552-206664574 ATCCTCCCGCCTCAACCTCGTGG - Intronic
945461211 2:210111003-210111025 ATCCTCCCGCCTCAGCTTCCTGG - Intronic
946508313 2:220325529-220325551 ATCTTGCCCTCTCAAAGTGCTGG + Intergenic
946682047 2:222227483-222227505 ATCCTCCCGCCTCAGTCTCCTGG - Intronic
947575932 2:231274222-231274244 ATTCTCCTGCCTCAAACTCCTGG + Intronic
947598394 2:231428790-231428812 ATCCACCTGCCTCAAAGTGCTGG - Intergenic
947883421 2:233542569-233542591 GTCCTCCCGCCTCAACCTCCTGG - Intronic
949012030 2:241686425-241686447 ATCCTCCCGCCTCAGCCTCCCGG - Intronic
1168946463 20:1763428-1763450 ATCCTCACCTCCCAAAGTGCTGG - Intergenic
1169073680 20:2749308-2749330 AACCACCAGCCTCAAGGTGCTGG + Intronic
1169437630 20:5607178-5607200 ATTCTCCCGCCTCAACCTCCTGG - Intronic
1169855604 20:10099222-10099244 AACCTCCCACCTCAAAGAGAAGG + Intergenic
1170209921 20:13838173-13838195 AGCCTCGCCCTTCAAAGTGCTGG - Intergenic
1173150329 20:40561746-40561768 ATCTGCCTGCCTTAAAGTGCTGG + Intergenic
1174219855 20:48945612-48945634 ATCCTCCTGCCTCAAAGTGCTGG - Intronic
1174660331 20:52206970-52206992 ATCCTGGCCTCTCAAAGTGCTGG + Intergenic
1174796655 20:53528115-53528137 ATCTACCTGCCTCAGAGTGCTGG + Intergenic
1174924421 20:54741856-54741878 ATCCTCCCGCCTCAGCTTCCCGG - Intergenic
1175896435 20:62337885-62337907 AACCTCCCGCCCCACAGAGCTGG + Exonic
1178192873 21:30306115-30306137 ATCTTCCTGCCTCAAACTCCTGG - Intergenic
1178568363 21:33710317-33710339 AACCGCCCGTCCCAAAGTGCTGG + Intronic
1179825726 21:43965169-43965191 ATCCTCCTGCCTCAGCCTGCTGG + Intronic
1180673767 22:17573004-17573026 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1180986367 22:19906378-19906400 ACCCTGGCCCCTCAAAGTGCTGG - Intronic
1181142416 22:20816179-20816201 ATCCACCTGTCCCAAAGTGCTGG + Intronic
1181410674 22:22716402-22716424 ATCCTCCCGTCTCAATTCGCTGG + Intergenic
1182470574 22:30545673-30545695 ATCCTCCCGCCTCAAAGTGCGGG + Intronic
1183643368 22:39106794-39106816 ATCCTCCCACCTCAAATTGTTGG - Intergenic
1183906612 22:41046050-41046072 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1184055066 22:42041227-42041249 AGCCTCCCCTCCCAAAGTGCTGG - Intronic
1184152594 22:42647362-42647384 ATCCCAGCTCCTCAAAGTGCTGG - Intronic
1184320690 22:43740067-43740089 CCCCTCCCGCCTCAAGGCGCTGG + Intronic
949471937 3:4405491-4405513 ATTCTCCCACCTCAATCTGCCGG + Intronic
949665929 3:6339276-6339298 ATCCTCCCGCCTCAATCTCCTGG + Intergenic
949803232 3:7926374-7926396 ATCCACCCGCCTTTAAGTGCTGG - Intergenic
949930312 3:9073248-9073270 ATCCTCCCACCTCAACCTCCCGG + Intronic
950720578 3:14879743-14879765 ATCCTCCCTGCTCAACGGGCTGG - Intronic
950966392 3:17149653-17149675 ATCCTCCTATCCCAAAGTGCTGG + Intergenic
950989726 3:17419937-17419959 ATCCTCCCGCCTCAGCCTGTTGG + Intronic
951566588 3:24017886-24017908 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
952217981 3:31296457-31296479 ATCCTCCCGCCTCAGCCTCCTGG - Intergenic
954027753 3:47796433-47796455 ATCCACCCACCCCAAAGTGCTGG - Intergenic
954788249 3:53111162-53111184 ATCCGCCTGCCTCAGAGTGCTGG - Intronic
954850205 3:53593680-53593702 ATTCTTCCCCCTCAAAGTGTGGG + Intronic
955219993 3:57015538-57015560 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
955235412 3:57134862-57134884 ATCCCCCTGCCTCAAAGTGCTGG - Intronic
956752290 3:72352948-72352970 ATCCACCTGCCTCAAACTCCTGG - Intergenic
959668797 3:108950983-108951005 TTTCTACCTCCTCAAAGTGCTGG - Intronic
961149290 3:124623224-124623246 ATCCTCCTGCCTCGGATTGCTGG + Intronic
961852309 3:129833327-129833349 ATCTTCCTGCCTCGGAGTGCTGG - Intronic
963064028 3:141248278-141248300 CTGCCCCGGCCTCAAAGTGCTGG + Intronic
963180023 3:142345175-142345197 ATCCTCCTGCCTCAGACTCCTGG + Intronic
965600175 3:170446625-170446647 ATCCTCCCACCTCAGACTCCTGG - Intronic
965747776 3:171943506-171943528 CACCTCCCTTCTCAAAGTGCTGG - Intergenic
966287595 3:178315800-178315822 ATAATCCCTCCCCAAAGTGCAGG + Intergenic
967398502 3:189033521-189033543 ATCTGCCCTCCTCAAAGTGCTGG + Intronic
967576231 3:191096717-191096739 ATCCTCCCGCCTCAGCTTCCTGG - Intergenic
967916031 3:194578983-194579005 ATCCGCCCCTCTCAAAGTGCTGG + Intergenic
970585326 4:17509618-17509640 ATCCTCTCGCCTCAACCTCCCGG - Intronic
972478525 4:39475768-39475790 ATCCTCCCACCTCAACCTCCTGG - Intronic
973241704 4:47963062-47963084 GTCCTCCCGCCTCAACCTTCTGG + Intronic
973900041 4:55459901-55459923 ATCCTCCTGCCTCAAAGTGGAGG + Intronic
975124748 4:70769103-70769125 ATACTCCTGCCCCAAAGTGCAGG - Intronic
975589591 4:75986909-75986931 ATCCTCCCGCCTCAGCCTCCAGG - Intronic
976335573 4:83881765-83881787 ATCTGCCCACCTCAAAGTGTTGG - Intergenic
976457498 4:85265365-85265387 CTCCTCCCCTCCCAAAGTGCTGG - Intergenic
977953297 4:102999075-102999097 AACTCCCAGCCTCAAAGTGCTGG + Intronic
978960317 4:114670188-114670210 ATCCACCCGCCTCATGCTGCTGG - Intronic
978983873 4:114984416-114984438 ATCCACCCATCCCAAAGTGCTGG + Intronic
979677550 4:123426638-123426660 ATCCGCCCGCCCCAAAGTGCTGG + Intergenic
982398023 4:154934485-154934507 ATCCTCCCACTTCAACCTGCAGG + Intergenic
982617410 4:157657309-157657331 ATCCTCCTGCCTCAGTGTCCAGG + Intergenic
982730294 4:158948717-158948739 ATCCTCCCACCTCAAGTAGCTGG + Intronic
982735353 4:159000733-159000755 ATCCACCCAACCCAAAGTGCTGG + Intronic
982762427 4:159301611-159301633 ATCCTCCCTCCTCAGAGTGCTGG - Intronic
984652115 4:182281594-182281616 ATCCTCCCACCTCAGACTCCTGG + Intronic
984837126 4:184032607-184032629 ATCCTCCCGCCTCAGCCTTCTGG + Intergenic
984911186 4:184676179-184676201 ATCCTGCCGCCTTAAACTCCTGG + Intronic
985174780 4:187189298-187189320 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
985320493 4:188705810-188705832 ATCCTCCTGCCTCAGTGTACAGG + Intergenic
986669431 5:10129580-10129602 ATCCTCCCACCTCAGTCTGCAGG - Intergenic
987354613 5:17052353-17052375 ATCTGCCCGCCTCAAAGTGCTGG + Intergenic
987782682 5:22459723-22459745 ATCCACCCGCCTCAAAGTGCTGG - Intronic
989058154 5:37384417-37384439 ATCCGCCCCTCCCAAAGTGCTGG - Intronic
989063183 5:37430958-37430980 ATCCTCCTGCCTCAACCTCCTGG + Intronic
990584717 5:57199955-57199977 ATCTACCTGCCGCAAAGTGCTGG + Intronic
991345935 5:65668358-65668380 ATCTTGGCCCCTCAAAGTGCTGG - Exonic
991642528 5:68769291-68769313 ATTCTCCAGCCGCAAAGTGAGGG + Intergenic
992272463 5:75079579-75079601 ATTCTCCTGCCTCAACCTGCTGG + Intronic
992692397 5:79253914-79253936 ATCCTGTCCCCTGAAAGTGCTGG + Intronic
992715660 5:79509083-79509105 CTCCTTCTGCCTCAAACTGCAGG - Intronic
992854677 5:80848120-80848142 ATCCTCCCACCTCAGCCTGCTGG - Intronic
992905536 5:81342095-81342117 ATCCTCCCACCTCAACCTCCTGG + Intronic
993668637 5:90732243-90732265 ATCCTCCTGCCTCAAAGTGCTGG + Intronic
994372556 5:98983766-98983788 ATCCTCTGGCCTTAAAGTGTTGG - Intergenic
995528186 5:113067396-113067418 ATCCACCTGCCTCAAAGTGCTGG - Intronic
996080447 5:119253298-119253320 ATCCTCCTGCCTCAAGTAGCTGG - Intergenic
996258830 5:121440370-121440392 ATCCTCCTGCCTCAGTGTCCCGG - Intergenic
996862450 5:128082878-128082900 ATCCTCCCTCCTCCAGGTTCAGG + Intergenic
997613408 5:135230618-135230640 AGCATCCAGCCTCCAAGTGCAGG + Intronic
998234528 5:140386902-140386924 ATCCTCCCACCTCAGACTACAGG + Intergenic
1001042289 5:168345344-168345366 ATCCTCACCTCCCAAAGTGCTGG + Intronic
1001458831 5:171890279-171890301 ATGCGCCTGCCCCAAAGTGCGGG - Intronic
1001614738 5:173033591-173033613 ATCCTCGCCTCCCAAAGTGCTGG - Intronic
1001621368 5:173088062-173088084 ATCCACCCACCTCGGAGTGCTGG + Intronic
1001779787 5:174357940-174357962 ATCCTCCCACCTCAGCGTACTGG - Intergenic
1001810215 5:174621858-174621880 ATCCTCCCGCCTCGGCTTGCTGG - Intergenic
1002008270 5:176253728-176253750 TTCCTATCACCTCAAAGTGCTGG + Intronic
1002376976 5:178795878-178795900 ATCCTCCCGCCTCAGCCTCCAGG - Intergenic
1004045740 6:12021133-12021155 ATCCAACCGCCTCAAAGTGCTGG + Intronic
1004237527 6:13887542-13887564 ATCCTCCCGCCTCAGCCTCCTGG - Intergenic
1006304396 6:33210349-33210371 ATCCTCACCTCCCAAAGTGCTGG - Intronic
1006651037 6:35551779-35551801 ATCCTCCTGCCTCAGACTCCTGG - Intergenic
1006656091 6:35594245-35594267 ATCCTCCCACCTCAAGCTCCTGG - Intronic
1006724083 6:36183744-36183766 ATCCTCCCACTTCAAACTGCTGG - Intergenic
1006864451 6:37197787-37197809 ATCCTCCCGCCTCAGCCTCCAGG - Intergenic
1009022028 6:57956268-57956290 ATCCGCCCCTCCCAAAGTGCTGG + Intergenic
1009897979 6:69776903-69776925 ATCTGCCCGTCTCAAAGTGCTGG - Intronic
1009943409 6:70316236-70316258 ATCCACCTGCCTCACAGAGCTGG - Intergenic
1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG + Intergenic
1012053551 6:94374932-94374954 ATCCTCATGCCGCAAAGTGAAGG + Intergenic
1013315977 6:108943575-108943597 ATCCATCTGCCGCAAAGTGCTGG - Intronic
1015412878 6:132914476-132914498 CTCCTCGGCCCTCAAAGTGCTGG + Intergenic
1015778478 6:136839072-136839094 ATCCTCCCACCTCAACCTCCCGG - Intronic
1015846302 6:137524190-137524212 ATACTTCTGTCTCAAAGTGCTGG + Intergenic
1016006082 6:139090657-139090679 ACCATCCCCTCTCAAAGTGCTGG - Intergenic
1016667053 6:146654458-146654480 ATCCTCCCACCTCAGATTCCTGG + Intronic
1016957961 6:149644512-149644534 ATCCTCCCACCTCAACCTCCTGG - Intronic
1016959922 6:149663365-149663387 ATCCTCCCACCTCAAGTAGCTGG - Intronic
1019314762 7:379346-379368 GTCCTCCCTGCTCAAAGTCCGGG + Intergenic
1019424906 7:970075-970097 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
1019568723 7:1697889-1697911 ATCCTCCCGCCTCAGCCTCCAGG + Intronic
1020040958 7:5000683-5000705 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1020089449 7:5330486-5330508 ATCCTCCCACCTCAAAGTGCTGG + Intronic
1023817875 7:43964091-43964113 ATCCTCCCACCTCAACGTTCCGG - Intergenic
1024773180 7:52749772-52749794 ATCCACCCTCCTCAAAGTGTTGG + Intergenic
1025751024 7:64293967-64293989 ATCCACCCACCTCAAAGTGCTGG - Intergenic
1026331587 7:69356722-69356744 ATCCTCCTGCCTCAGCGTCCTGG - Intergenic
1026355122 7:69550786-69550808 ATCCTCCCGCCTCAGACTACAGG - Intergenic
1026850448 7:73720032-73720054 ATCCTCCCGCCTCAGTCTCCTGG + Intergenic
1027159468 7:75791723-75791745 ATCCTCCCGCCTGGGAGTGCTGG - Intergenic
1027159566 7:75792364-75792386 ATCCTCCCACCTGGGAGTGCTGG - Intergenic
1027704686 7:81514469-81514491 ATCCTCACCCCTCAATGTGATGG + Intergenic
1027775600 7:82460982-82461004 ATCAACCCTCCTCAAATTGCTGG - Intergenic
1027900509 7:84108278-84108300 ATCCTCTAGCCTCAGACTGCAGG - Intronic
1029591309 7:101508896-101508918 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1030151394 7:106409172-106409194 ATCCTGCCCTCCCAAAGTGCTGG - Intergenic
1031708246 7:125010150-125010172 ATCTGCCCGCCCCAAAGTGCTGG + Intergenic
1032279290 7:130487892-130487914 CTGCTTCAGCCTCAAAGTGCTGG + Intronic
1035083423 7:156236291-156236313 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1035433858 7:158843199-158843221 ATTCTCCCACCTCAAACTCCTGG + Intergenic
1035653255 8:1284839-1284861 GGCCTCCCACCTCAAAGTGCTGG + Intergenic
1036168163 8:6457341-6457363 ATCCGCCCGCCCCAAAGTACCGG - Intronic
1040448746 8:47523105-47523127 ATCCTCCCACCTCGAATTGTTGG + Intronic
1041098591 8:54373708-54373730 ATCCTCCCGCCTCAGCCTCCCGG - Intergenic
1042551054 8:69994469-69994491 ATCCGCCAGCCCCAAAGTGCCGG + Intergenic
1042886187 8:73554539-73554561 ATAATCCCTCCTCACAGTGCAGG - Intronic
1045089163 8:98721421-98721443 ATCCTCCCACCTCAGTCTGCTGG - Intronic
1047414686 8:124654466-124654488 TTCCTCCCTCCTCAAAGATCAGG + Intronic
1048217255 8:132507723-132507745 ATCCTCTCACTTAAAAGTGCTGG + Intergenic
1049690336 8:143955839-143955861 ATCCTCCCACCTCCCAGTGCTGG + Intronic
1049792144 8:144477087-144477109 ATCCTCCCGACTCAGCGTCCCGG + Intergenic
1052840916 9:33290191-33290213 ATCCTCCCGCCTCAGCCTTCCGG - Intergenic
1052914542 9:33914583-33914605 ATCCACCCGCCTCAAAATGTTGG - Intronic
1053044800 9:34906709-34906731 ATTCCCCCCACTCAAAGTGCAGG + Intergenic
1053084991 9:35211852-35211874 ATCCTCCCGCCTCAGCCTCCGGG - Intronic
1053467290 9:38318009-38318031 ACCCTCCAGCCTCAAAGAGGTGG - Intergenic
1055323337 9:75103184-75103206 AACCTCCTGCCTCAAACTCCTGG - Intronic
1057470535 9:95352100-95352122 ATCCGCCCATCCCAAAGTGCTGG - Intergenic
1057716389 9:97499133-97499155 ATCCGCCCACCTCAAAGTGCTGG - Intergenic
1057754860 9:97825068-97825090 ATCCTCCCCAGTCAAAGTGCTGG - Intergenic
1057766396 9:97922957-97922979 ATCCTCCCGCCTCAATCTCCTGG - Intergenic
1058240830 9:102556780-102556802 CACCTCACCCCTCAAAGTGCTGG - Intergenic
1058868267 9:109181116-109181138 ATCCTCCCGCCTCAGCCTCCTGG + Intronic
1059136096 9:111807904-111807926 GTCCTCCTGCCTAAAAGTGCTGG - Intergenic
1059215045 9:112553418-112553440 ATCCTCCTGCTTCAGTGTGCTGG + Intronic
1059316720 9:113431964-113431986 ATCCTCCTGCCTCAAATTGTTGG + Intergenic
1060483517 9:124032133-124032155 ATCCTCCCGCCTCAGCCTCCTGG - Intronic
1061184768 9:129046380-129046402 ATCCACCTGCCCCAAAGTACTGG - Intronic
1061785982 9:133028851-133028873 ATTCTCCTGCCTCAAACTCCCGG - Intergenic
1062309037 9:135926003-135926025 ATCCTCCCGCCTCAGCCTCCAGG - Intergenic
1062717135 9:138016669-138016691 AGCCTCCCGCCGCAGGGTGCGGG + Intronic
1062717157 9:138016756-138016778 AGCCTCCCGCCGCAGGGTGCAGG + Intronic
1186146657 X:6631424-6631446 ATCCTCCCACCTCAGCGTTCTGG + Intergenic
1186283726 X:8022095-8022117 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1187455526 X:19438214-19438236 AAACTCCTGCCTCAGAGTGCTGG + Intronic
1187504793 X:19870447-19870469 ATCCTCCCACCTCAGTGTCCTGG + Intronic
1188145234 X:26603850-26603872 ATCCTCCCACCTCAGTGTCCTGG - Intergenic
1189115876 X:38342260-38342282 ATCCGCCCGCCTCAAAGTGCTGG + Intronic
1189289851 X:39877380-39877402 ATCCTCCCGCCTCAGCCTCCTGG + Intergenic
1190848728 X:54217377-54217399 ATCCACCCGCCCCAAAGTGCTGG - Intronic
1190957610 X:55210816-55210838 ATTCTCCTGCCTCAAAATGCTGG - Intronic
1191045068 X:56127417-56127439 ATCCTCCCACCTCAAATTGCTGG - Intergenic
1193658423 X:84225868-84225890 AAGCTCCAGCCTCAAAGGGCAGG + Intergenic
1195990136 X:110674240-110674262 ATACTCCTGCCTCCAGGTGCTGG - Intronic
1196355651 X:114788753-114788775 ATCCTCCCACCTCAGACTCCTGG + Intronic
1196858031 X:120001489-120001511 ATCCTCCCGCCTCAGCCTCCTGG - Intergenic
1198212658 X:134530147-134530169 ATCCACCTGCCTCGGAGTGCTGG + Intergenic
1198382790 X:136099994-136100016 ATCCTCGCCTCCCAAAGTGCTGG + Intergenic
1200185646 X:154181502-154181524 ATCCTCCCGTCTCAGCGTCCTGG - Intergenic
1200191299 X:154218642-154218664 ATCCTCCCGTCTCAGCGTCCTGG - Intergenic
1200197054 X:154256446-154256468 ATCCTCCCGTCTCAGCGTCCTGG - Intergenic
1200202705 X:154293563-154293585 ATCCTCCCGTCTCAGCGTCCTGG - Intronic
1201441227 Y:14010549-14010571 ATCCTCCCACCTCAAAGCACTGG - Intergenic
1201443344 Y:14032159-14032181 ATCCTCCCACCTCAAAGCACTGG + Intergenic
1201904205 Y:19073233-19073255 ATCCTCCCACCTCAGACTCCTGG - Intergenic