ID: 1182470951

View in Genome Browser
Species Human (GRCh38)
Location 22:30547963-30547985
Sequence CCTGATTGTCACTTACTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182470951_1182470957 26 Left 1182470951 22:30547963-30547985 CCATGTAGTAAGTGACAATCAGG No data
Right 1182470957 22:30548012-30548034 GACATTGTATCCCACATGCCTGG No data
1182470951_1182470955 4 Left 1182470951 22:30547963-30547985 CCATGTAGTAAGTGACAATCAGG No data
Right 1182470955 22:30547990-30548012 TCTGGACCTGGTGCTTACTCAGG No data
1182470951_1182470954 -8 Left 1182470951 22:30547963-30547985 CCATGTAGTAAGTGACAATCAGG No data
Right 1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182470951 Original CRISPR CCTGATTGTCACTTACTACA TGG (reversed) Intergenic
No off target data available for this crispr