ID: 1182470954

View in Genome Browser
Species Human (GRCh38)
Location 22:30547978-30548000
Sequence CAATCAGGACTATCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182470949_1182470954 7 Left 1182470949 22:30547948-30547970 CCTGGGGCCATACAGCCATGTAG No data
Right 1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG No data
1182470950_1182470954 0 Left 1182470950 22:30547955-30547977 CCATACAGCCATGTAGTAAGTGA No data
Right 1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG No data
1182470945_1182470954 29 Left 1182470945 22:30547926-30547948 CCTGGAAGAGGGAAGCAGCATGC No data
Right 1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG No data
1182470951_1182470954 -8 Left 1182470951 22:30547963-30547985 CCATGTAGTAAGTGACAATCAGG No data
Right 1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182470954 Original CRISPR CAATCAGGACTATCTGGACC TGG Intergenic
No off target data available for this crispr