ID: 1182471856

View in Genome Browser
Species Human (GRCh38)
Location 22:30553762-30553784
Sequence ATAGGGGGGCAGAAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182471838_1182471856 29 Left 1182471838 22:30553710-30553732 CCCAGGGCTTTTGTTGGGGCAGA No data
Right 1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG No data
1182471839_1182471856 28 Left 1182471839 22:30553711-30553733 CCAGGGCTTTTGTTGGGGCAGAG No data
Right 1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182471856 Original CRISPR ATAGGGGGGCAGAAGTAGGA GGG Intergenic
No off target data available for this crispr