ID: 1182472525

View in Genome Browser
Species Human (GRCh38)
Location 22:30557251-30557273
Sequence GGGCCACTCACGTGGAGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 128}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182472508_1182472525 29 Left 1182472508 22:30557199-30557221 CCATGGGTGGGGTGCCATCCCTC 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472519_1182472525 -5 Left 1182472519 22:30557233-30557255 CCCATCATCTGCCCAGCTGGGCC 0: 1
1: 0
2: 2
3: 62
4: 551
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472510_1182472525 11 Left 1182472510 22:30557217-30557239 CCCTCCCCCACCTACACCCATCA 0: 1
1: 0
2: 3
3: 65
4: 755
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472515_1182472525 4 Left 1182472515 22:30557224-30557246 CCACCTACACCCATCATCTGCCC 0: 1
1: 0
2: 3
3: 26
4: 322
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472512_1182472525 7 Left 1182472512 22:30557221-30557243 CCCCCACCTACACCCATCATCTG 0: 1
1: 0
2: 1
3: 32
4: 349
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472514_1182472525 5 Left 1182472514 22:30557223-30557245 CCCACCTACACCCATCATCTGCC 0: 1
1: 0
2: 3
3: 22
4: 244
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472507_1182472525 30 Left 1182472507 22:30557198-30557220 CCCATGGGTGGGGTGCCATCCCT 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472513_1182472525 6 Left 1182472513 22:30557222-30557244 CCCCACCTACACCCATCATCTGC 0: 1
1: 0
2: 2
3: 25
4: 296
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472509_1182472525 15 Left 1182472509 22:30557213-30557235 CCATCCCTCCCCCACCTACACCC 0: 1
1: 0
2: 30
3: 274
4: 2113
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472520_1182472525 -6 Left 1182472520 22:30557234-30557256 CCATCATCTGCCCAGCTGGGCCA 0: 1
1: 0
2: 3
3: 20
4: 368
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472511_1182472525 10 Left 1182472511 22:30557218-30557240 CCTCCCCCACCTACACCCATCAT 0: 1
1: 0
2: 3
3: 52
4: 580
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1182472516_1182472525 1 Left 1182472516 22:30557227-30557249 CCTACACCCATCATCTGCCCAGC 0: 1
1: 0
2: 2
3: 27
4: 293
Right 1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182472525 Original CRISPR GGGCCACTCACGTGGAGGCC AGG Exonic
901971300 1:12911326-12911348 TGGCCACTCAAGTGGACACCAGG + Intronic
902013869 1:13290414-13290436 TGGCCACTCAAGTGGACACCAGG - Intergenic
902536454 1:17121661-17121683 GGGCCACTGGGGTGGAGGCAGGG + Intergenic
904836554 1:33341297-33341319 GGGCCACACAGGTGGAGGGAGGG + Intronic
907162772 1:52383495-52383517 GGCCCACTCATAAGGAGGCCCGG - Exonic
911268128 1:95767622-95767644 TGGCCTCTCACGTGGAGATCTGG - Intergenic
915283214 1:154836781-154836803 GGGCCACTCAGAGGGAGCCCAGG - Intronic
915335741 1:155140180-155140202 GGGCCACCCAGGTGGAGCCCAGG + Exonic
917501313 1:175587910-175587932 GGGCCACTCACATGGTGGAGGGG + Intronic
921055473 1:211539389-211539411 GGGACATTCACGTGAAGGCAAGG - Intergenic
921261451 1:213388429-213388451 CAGCCACTCAGGTGGGGGCCTGG + Intergenic
921873001 1:220161444-220161466 TGGCCACTCAGCTGGAGGCTAGG + Intronic
922632140 1:227126218-227126240 AGGCCACACACCTGGAGGTCAGG - Intronic
922763688 1:228147073-228147095 GGGCCACAGACGTGGGAGCCTGG - Intronic
1063578905 10:7287625-7287647 GGGCTGCCCACGTGGAGGGCTGG - Intronic
1070041622 10:72786516-72786538 GGGCAGATCACGTGGAGGTCAGG + Intronic
1070828717 10:79405866-79405888 GGGCCACTCTGGCAGAGGCCTGG + Intronic
1072620035 10:97073669-97073691 GGAGCACTCACGGAGAGGCCAGG + Intronic
1075638979 10:124050725-124050747 AAGCCAGTCACGTGGAGACCAGG + Intronic
1075851332 10:125590241-125590263 GTGCCACTCACCTGTAGTCCTGG - Intronic
1076382921 10:130037459-130037481 GGGCCACTCCCTTGGAGACCGGG - Intergenic
1076395809 10:130136668-130136690 GGGCCACTCACGCGGAGGCTCGG - Intronic
1076582285 10:131519948-131519970 GGGCCACTCATGGAGAGGCGTGG + Intergenic
1076777442 10:132705537-132705559 TGGCCACGCACTTGGACGCCAGG - Intronic
1077306563 11:1871274-1871296 GGGCCACCCACGAGCAGGGCGGG + Intronic
1082814235 11:57497803-57497825 GGGCCATTAACGTGGAGCGCAGG + Exonic
1083477469 11:62923469-62923491 GGGGCACTCAGGAGGAGGCAGGG - Intergenic
1083932636 11:65854284-65854306 GGGCCAGCCAGGTGGAGCCCGGG - Intronic
1085036314 11:73302354-73302376 GAGCCACAGACGTGGAGGGCAGG + Intergenic
1087812383 11:102622475-102622497 GAGCCAGTCACGTGAAGACCTGG - Intronic
1094752645 12:33429886-33429908 TGGCCAATCACTGGGAGGCCAGG + Intronic
1096489213 12:52004658-52004680 TGTTCACTCACTTGGAGGCCTGG + Intergenic
1098435882 12:70468009-70468031 GGCCCACTGAGGTGGAGCCCCGG + Intergenic
1103725921 12:122997314-122997336 ATGCCACTCACTTGGAGACCAGG + Exonic
1107560176 13:41551188-41551210 GGGCTTCTCACATGGAGGCTCGG + Intergenic
1112887230 13:104189170-104189192 GCACCACCCACGTGGAGACCTGG - Intergenic
1113558022 13:111254358-111254380 GTGCCACTAACATGAAGGCCGGG + Intronic
1121107319 14:91289451-91289473 AGGCCACTCACGTGGGGTTCAGG + Intronic
1121788359 14:96680014-96680036 GGGCCTGACAAGTGGAGGCCTGG + Intergenic
1122405119 14:101496336-101496358 TGGCTAGTCACGTGGAGGCTTGG - Intergenic
1122406435 14:101503795-101503817 GGGCCACTGTGCTGGAGGCCTGG + Intergenic
1122689000 14:103522755-103522777 GGCCCACTCACCGGGCGGCCGGG + Exonic
1123138954 14:106056427-106056449 GGGCCACTGATGTGGAGCACAGG - Intergenic
1123217964 14:106830239-106830261 GGGCCACCAAAGTGGAGGACAGG + Intergenic
1125736723 15:41932283-41932305 CGCCCACTCACGTGGAGCCCTGG - Intronic
1126140155 15:45430644-45430666 GGGAGACTCACCTGGACGCCGGG - Exonic
1127682120 15:61308054-61308076 GGTCCTCTCACTTGGAGACCTGG + Intergenic
1129217098 15:74106745-74106767 GGGCCTCCCACCTGGGGGCCCGG + Intronic
1129407576 15:75329312-75329334 GGGCCTCCCACCTGGGGGCCCGG - Intergenic
1130012597 15:80163252-80163274 GCGCATCTCACGTGGAAGCCTGG - Intronic
1133211141 16:4264024-4264046 GGGCCCCTCAGGAAGAGGCCGGG - Intronic
1136409359 16:30067146-30067168 GGGCCCCTCTCCTGGAGGTCAGG - Intronic
1136655294 16:31705840-31705862 GGGCCACACACCAGGAGGCCTGG + Intergenic
1136984144 16:35083902-35083924 GGGCCACACTCCAGGAGGCCTGG + Intergenic
1137567212 16:49540811-49540833 GAGCCATCCACATGGAGGCCAGG - Intronic
1138658233 16:58502770-58502792 GGGCCACTCACGTGGTTCCCAGG + Intronic
1141896599 16:86962551-86962573 AAGCCACTCACTTGGAGCCCGGG + Intergenic
1143204247 17:5131651-5131673 GGGCCTCTCACGGTGAGGCCAGG + Intronic
1143493042 17:7294797-7294819 GGGGCCGTCACGTGGCGGCCAGG - Intergenic
1144025761 17:11274543-11274565 AGGCCACTCAGATGGAGGCTGGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146844433 17:36174171-36174193 GGGCATCTCACGGTGAGGCCAGG - Intronic
1146856737 17:36262106-36262128 GGGCATCTCACGGTGAGGCCAGG - Intronic
1146863880 17:36326269-36326291 GGGCATCTCACGGTGAGGCCAGG + Intronic
1146872647 17:36386017-36386039 GGGCATCTCACGGTGAGGCCAGG - Intronic
1146880006 17:36437102-36437124 GGGCATCTCACGGTGAGGCCAGG - Intronic
1147066739 17:37926857-37926879 GGGCATCTCACGGTGAGGCCAGG + Intronic
1147075532 17:37986641-37986663 GGGCATCTCACGGTGAGGCCAGG - Intronic
1147078271 17:38006418-38006440 GGGCATCTCACGGTGAGGCCAGG + Intronic
1147087057 17:38066187-38066209 GGGCATCTCACGGTGAGGCCAGG - Intronic
1147094209 17:38130353-38130375 GGGCATCTCACGGTGAGGCCAGG + Intergenic
1147103002 17:38190150-38190172 GGGCATCTCACGGTGAGGCCAGG - Intergenic
1149847574 17:60016617-60016639 GGGCATCTCACGGTGAGGCCGGG - Intergenic
1150085932 17:62273234-62273256 GGGCATCTCACGGTGAGGCCGGG - Intronic
1155072100 18:22325490-22325512 GGGCCACTCACGCTAAGCCCAGG - Intergenic
1159692375 18:71504913-71504935 GGGCCACTCTCATGGAAGCCAGG - Intergenic
1161006077 19:1937449-1937471 GGGCCACTCATTCTGAGGCCGGG - Intergenic
1161325826 19:3663543-3663565 GGGCCACGCACCTGGAATCCCGG + Intronic
1161521350 19:4725417-4725439 GGGCGAATCACGTTGAGGTCAGG - Intergenic
1163273638 19:16268976-16268998 GGGCAGCTCACGAGGAAGCCAGG - Intergenic
1163826001 19:19525402-19525424 GGGCCAGTGCCCTGGAGGCCTGG + Intronic
1167605319 19:50478846-50478868 TGGTCACTCGGGTGGAGGCCAGG + Intronic
1167636560 19:50659189-50659211 GGGCCACCCACCCGGAGCCCCGG + Exonic
925180822 2:1815879-1815901 GTGCCTCTCACCTGGATGCCTGG - Intronic
926153730 2:10439031-10439053 GGGCCACTCACGTGTAGCACGGG + Intergenic
927469413 2:23361570-23361592 GGCCCACTCACATGCAGGCCAGG + Intergenic
932457002 2:71856316-71856338 GGCCCACTCAAGTGGAGATCAGG + Intergenic
932493102 2:72133822-72133844 GGGCCACTCCCCTGGAGACCTGG + Intronic
933190026 2:79324234-79324256 GGGGCACCCACCTGGAGGCAGGG + Intronic
933258286 2:80105234-80105256 TGGCCTGTCACGTGTAGGCCTGG - Intronic
933702286 2:85263983-85264005 GGGCCAGTGACGTGGAAGGCAGG + Intronic
935182691 2:100704797-100704819 GGACCACTCACATGGAGGAACGG - Intergenic
944902935 2:204234391-204234413 TGGCCACTCAGATGGAGGCCCGG + Intergenic
948437068 2:237961074-237961096 AGGACACTCAAGTGCAGGCCTGG - Intergenic
1170915331 20:20618578-20618600 AGGCCTCTCATGTAGAGGCCAGG - Intronic
1171229867 20:23475647-23475669 GGGACACTCAGGTGGAGGAGTGG - Intergenic
1174573039 20:51516916-51516938 CGGCCACTCAAGTGGAGGGAGGG + Exonic
1179304504 21:40142088-40142110 GGGGCACTCAGGAGGGGGCCAGG - Intronic
1179597896 21:42455347-42455369 GGTCCACTCACCAGGATGCCAGG - Intergenic
1180057087 21:45364636-45364658 GGGCCAAGCACCAGGAGGCCAGG + Intergenic
1181311390 22:21946676-21946698 GGGCCACCCAAGGGGTGGCCAGG + Intronic
1181622207 22:24098873-24098895 GGACCACTAAAGTGGAGTCCTGG + Intronic
1181777553 22:25170518-25170540 GGGCCATTGAGGTGGGGGCCAGG + Intronic
1182472525 22:30557251-30557273 GGGCCACTCACGTGGAGGCCAGG + Exonic
1184254324 22:43278505-43278527 GGGCCCCTCAGGTCAAGGCCTGG + Intronic
1184700873 22:46171759-46171781 GGACCAGTCTCGTGGAGGTCGGG + Intronic
1185347665 22:50317521-50317543 TGGCCACCAAGGTGGAGGCCAGG + Intronic
1185394767 22:50581320-50581342 GATCCACTCAAGTGGAGGGCTGG + Intronic
954136816 3:48585679-48585701 GGGACACTCACCGGGAGGCCAGG + Exonic
963073918 3:141328947-141328969 GGAGCACTCAGGAGGAGGCCTGG - Intronic
968687915 4:1973872-1973894 CGGCTCCTCAGGTGGAGGCCGGG + Intronic
968913595 4:3487615-3487637 GGTGCACCCCCGTGGAGGCCAGG - Intronic
982523733 4:156452215-156452237 GGGCCACTGAGGTGGCAGCCAGG - Intergenic
985196038 4:187430723-187430745 CTGACACTCACGTGGAGGCCTGG - Intergenic
985589646 5:757872-757894 GGGGGACTCACATGGGGGCCAGG + Intronic
995450455 5:112294321-112294343 GGGCCGCTCACTGGGAGGCGAGG - Intronic
997276411 5:132596220-132596242 GGGCCAATCACTTTGAGGCCAGG - Intronic
997436287 5:133877983-133878005 GGGCTATTCCTGTGGAGGCCTGG - Intergenic
1001400997 5:171446369-171446391 GGGCCTCTCCCCTGGAGCCCAGG + Intronic
1002792817 6:448138-448160 AGGCCACTGCCATGGAGGCCTGG + Intergenic
1004282608 6:14293650-14293672 GGCCCACCCACGTGGAGCGCTGG - Intergenic
1006611741 6:35298184-35298206 GGGCCCCACAACTGGAGGCCAGG + Intronic
1007171359 6:39865601-39865623 GGGCCCCACACGTTGTGGCCTGG - Intronic
1011563673 6:88649881-88649903 GGTCCACTCTCCTTGAGGCCTGG - Intronic
1012157579 6:95839439-95839461 GGCCCACTCACGTGGTGTTCGGG + Intergenic
1013106194 6:107028358-107028380 GGGACACTCACGGGGAGACCCGG - Exonic
1017865848 6:158442548-158442570 TGGCCACTCACCAAGAGGCCTGG - Intronic
1018795471 6:167181907-167181929 GGGGCCCTGACCTGGAGGCCAGG + Exonic
1018820851 6:167373156-167373178 GGGGCCCTGACCTGGAGGCCAGG - Exonic
1019348764 7:543370-543392 GGGTGACTCACTTTGAGGCCAGG - Intergenic
1019529162 7:1495057-1495079 GGACCACTCACGGGGCTGCCAGG + Intronic
1021114370 7:16731404-16731426 AGGCCACGTACGTGGAGGTCAGG - Intergenic
1027529137 7:79308459-79308481 GGGCCACTGATGTGGAGGAAGGG - Intronic
1035556167 8:568946-568968 GGGAGACTCACGGGCAGGCCGGG + Intergenic
1039364637 8:36917011-36917033 GAGCCACTGAGGTGGAGACCAGG - Intronic
1041084888 8:54247678-54247700 GGTCCACCCAGGTGGAGCCCAGG - Intergenic
1044100019 8:88123485-88123507 GGGCCACTCTCTTGGTGGTCAGG + Intronic
1045567824 8:103339479-103339501 GGGCCACACACCTGCAGGCCAGG + Intergenic
1048152142 8:131904311-131904333 CGGCCACTCACGGGTAGGCATGG - Exonic
1048269909 8:133020321-133020343 GGGCCTGTCACCTGGAGGCCAGG - Intronic
1060597328 9:124856338-124856360 GGGCCACTGAGGTGGGGCCCAGG - Intronic
1061324370 9:129854183-129854205 GGGCCACTCACGTTGTGGTAGGG + Intronic
1062350306 9:136135468-136135490 GGGCCACCCACCTGGAAGCGTGG + Intergenic
1062429097 9:136519099-136519121 GGGCCAGTCACAGGGATGCCTGG - Intronic
1062450043 9:136611340-136611362 TGGCCACTCATGTGGAGTCCAGG + Intergenic
1187056739 X:15747847-15747869 GGGACACACACGTGGAGTTCAGG + Intronic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic