ID: 1182473487

View in Genome Browser
Species Human (GRCh38)
Location 22:30562714-30562736
Sequence CCTCATCCACATTCTCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182473487_1182473492 15 Left 1182473487 22:30562714-30562736 CCGTGCAGAGAATGTGGATGAGG 0: 1
1: 0
2: 0
3: 25
4: 241
Right 1182473492 22:30562752-30562774 ACAACACCTCACTGAGACACAGG 0: 1
1: 0
2: 0
3: 8
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182473487 Original CRISPR CCTCATCCACATTCTCTGCA CGG (reversed) Intronic
901486154 1:9563565-9563587 CCTCTTCCACTTTCTCCACAGGG - Intronic
901771222 1:11531336-11531358 CCTCATCCACATTGGCTGTGGGG - Intronic
901890705 1:12261079-12261101 CCTCAACCACATTCCCTTCTGGG - Exonic
901922521 1:12547327-12547349 CCTCCTCCACCCTCTCTCCAGGG + Intergenic
902708497 1:18222748-18222770 CATCTTCCACATACCCTGCACGG - Intronic
902719319 1:18293476-18293498 TCACGTCCACATTCTCAGCATGG - Intronic
902788287 1:18747100-18747122 CGTCATCCACATTCCTTGAATGG + Intronic
903316186 1:22509212-22509234 CCTCTTTCACAGTCTCTGCCAGG - Exonic
906111392 1:43324550-43324572 TCAGATCCACATTCACTGCAGGG + Intergenic
906667371 1:47631473-47631495 CCTGAACCACAACCTCTGCAGGG + Intergenic
906866537 1:49427274-49427296 CCTAGCCCACATTCTCTTCAAGG - Intronic
908440179 1:64145838-64145860 CCTCATCCTCATACTCTGACAGG + Intronic
910757886 1:90710727-90710749 CCTCCTCCACACTCTGGGCAGGG + Intergenic
912273132 1:108230045-108230067 CCACATCTTCATTCTCTCCAAGG + Intronic
912295088 1:108464277-108464299 CCACATCTTCATTCTCTCCAAGG - Intronic
913536696 1:119779833-119779855 CCTCATCCACTTTTTTTGCGGGG - Intergenic
915243509 1:154540766-154540788 CCCCATCCACCTTCTCTCCAAGG - Intronic
916492724 1:165316071-165316093 CCTCACCCACAGTCTGTCCATGG + Intronic
919522367 1:198604239-198604261 CCTTCTCCACACTCACTGCAAGG + Intergenic
919764861 1:201120445-201120467 CCTCAGCCTTATACTCTGCATGG + Intronic
921266515 1:213425076-213425098 CCTCATCCACATTCTGAGGATGG + Intergenic
921287168 1:213619582-213619604 CCTAATCCCCACTCTCTCCAAGG - Intergenic
921938717 1:220818036-220818058 CTTCAACCACTTTCTCTGAATGG + Exonic
922222704 1:223620602-223620624 ACTCATCCACGTTCTCTCCTGGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063302712 10:4866248-4866270 CCACATCCACATTCTTTTGACGG + Intergenic
1065850515 10:29783861-29783883 CCTCATCTCCTTTCTCTCCAGGG - Intergenic
1066083501 10:31955293-31955315 CCTCATGCAGATCCTCTGCTAGG + Intergenic
1067377515 10:45741473-45741495 CCTCCACAACTTTCTCTGCAAGG - Intronic
1067885217 10:50082158-50082180 CCTCCACAACTTTCTCTGCAAGG - Intronic
1069422654 10:68260882-68260904 CCACATCAACGTTCTGTGCAGGG + Intergenic
1069771474 10:70903253-70903275 GCTCAGCCACCTTCTCTGCCCGG - Intergenic
1070739683 10:78894547-78894569 CCCCTTCCACATCCTCTGCCTGG - Intergenic
1072319279 10:94233053-94233075 TCAGATCCACTTTCTCTGCATGG + Intronic
1074134608 10:110615790-110615812 CCTCATCCACCTTCTCTCTCAGG + Intergenic
1075586538 10:123662560-123662582 CCTCAGCCACCTTCTCAGGAAGG - Intergenic
1076050034 10:127325059-127325081 GCTCATCCACATACCTTGCATGG + Intronic
1079139160 11:17796243-17796265 TCTCATGGCCATTCTCTGCATGG - Intronic
1080487318 11:32723010-32723032 CAGCATCCACAATCTCTTCAAGG - Intronic
1081260638 11:40955940-40955962 TCTCATTCACATTCTCCGAAGGG + Intronic
1082108535 11:48245969-48245991 CCTAATCCACAGCCTCTTCATGG - Exonic
1086010513 11:82097641-82097663 CCACACCCTCATTCTCTGCCTGG - Intergenic
1086010676 11:82099268-82099290 CCACACCCTCATTCTCTGCCTGG + Intergenic
1087341721 11:96915487-96915509 CCTCATCTCCATTCTCAGCCTGG - Intergenic
1088728046 11:112656692-112656714 TCTTATTCAGATTCTCTGCAGGG + Intergenic
1089195063 11:116689490-116689512 ACTCATCCCCACTCTCTGAAAGG + Intergenic
1089332132 11:117696950-117696972 CCTCCTCCACAGACTCTTCAGGG + Intronic
1090098855 11:123772629-123772651 CCTTATTTACATTCTCTGCCAGG - Intergenic
1090818465 11:130318952-130318974 CCTTTTCCTCATTCTCTACATGG + Intergenic
1090924955 11:131241334-131241356 CCTCATCCTCATCCTGTCCAGGG + Intergenic
1090956251 11:131515263-131515285 CCTCACCCACAGTGTTTGCAAGG + Intronic
1091867910 12:3858330-3858352 CTACAGCCACTTTCTCTGCATGG - Intronic
1092228772 12:6765830-6765852 CTCCATCCACATTCTCTGGATGG - Intronic
1094748942 12:33382383-33382405 CCTGGTCCACGTTCTCTGGAGGG + Exonic
1096844339 12:54397364-54397386 ACTCATCTACATCCTCTACAAGG - Exonic
1096845132 12:54402257-54402279 CCTCACCCACATTCTGGGCATGG + Exonic
1097324274 12:58258175-58258197 GCTCCTCCTCACTCTCTGCAAGG - Intergenic
1098174116 12:67773093-67773115 CCTTCTCCACATTGTCTGGATGG + Intergenic
1102035977 12:109770789-109770811 CCTCTTCCTCATTCCCTTCATGG + Intergenic
1103042991 12:117711325-117711347 CCCCATCCCCATTCTTTGCATGG - Intronic
1103592770 12:122004152-122004174 CCTCATTCCCTTTCCCTGCAGGG + Intergenic
1104114291 12:125734588-125734610 CCTCAACCGCATCCTCTGAAAGG - Intergenic
1104673219 12:130694627-130694649 GCTCATCCTTCTTCTCTGCATGG + Intronic
1106316988 13:28603033-28603055 CCTCCTCCACATTCTGTGACAGG - Intergenic
1106648489 13:31663036-31663058 CCTCATCAAACTTCTCTGCAAGG + Intergenic
1108417124 13:50209127-50209149 CCTCCTCCACATCCTCTCCCAGG - Intronic
1109164211 13:59013040-59013062 CCTGGGCCACAGTCTCTGCAAGG + Intergenic
1110248135 13:73351166-73351188 CCTAGTCAACATTTTCTGCAGGG - Intergenic
1111577710 13:90179906-90179928 CGTCATCCTCATTTTATGCATGG + Intergenic
1111876525 13:93904039-93904061 TGTCATCCATATTCTCTGCTTGG - Intronic
1112167682 13:96937035-96937057 GCTCAGTCAGATTCTCTGCAAGG + Intergenic
1113081707 13:106526925-106526947 CCCAATCCACATTCCCTGCGGGG - Intronic
1116324939 14:43520840-43520862 CATAATAAACATTCTCTGCAAGG + Intergenic
1116420395 14:44725616-44725638 CCTGATCTACAATATCTGCAGGG - Intergenic
1117006459 14:51425648-51425670 TCTCAGCCACATTCTGTGTATGG + Intergenic
1117308293 14:54497566-54497588 CCTCATCCACTTTTTGTTCAGGG + Intergenic
1121982495 14:98467245-98467267 CCTAATCCACTCTCTCTGCTTGG + Intergenic
1122479038 14:102033883-102033905 GTTCATCCACATTATGTGCAGGG - Intronic
1122782681 14:104150225-104150247 CCCCCTCCTCCTTCTCTGCAGGG + Intronic
1124200294 15:27673552-27673574 CTTCCTCCACTTTCTCTGCTTGG + Intergenic
1125731157 15:41893501-41893523 CCTCATCCCCAAAGTCTGCAGGG - Exonic
1128391594 15:67186279-67186301 CCTCTTCTTCATTCTCTCCAAGG - Intronic
1132421504 15:101673733-101673755 CTTCTTCCACATCCACTGCATGG - Intronic
1133050417 16:3114346-3114368 CCTCATGACCATTCTGTGCAGGG + Intronic
1134128448 16:11632345-11632367 CCTCCTTCACCTTCTCTCCAGGG - Intronic
1134163320 16:11910307-11910329 CCTTCTCTACACTCTCTGCAGGG + Intronic
1135649520 16:24193717-24193739 CCTCATTCATATTATCTGCTTGG - Intronic
1135665475 16:24331939-24331961 CCCCAATCACATTCTCTCCAGGG + Intronic
1136083603 16:27868858-27868880 ACTCATCCACATTCCCTCCCAGG + Intronic
1137339325 16:47584483-47584505 CCTCATGCACATACTGTGAAAGG - Intronic
1138442330 16:57042510-57042532 CCTCCTACACACTCTCTGCCAGG - Intronic
1140107679 16:71975913-71975935 TCTCATCCAGTTTCTCTGAATGG - Intronic
1141204560 16:81923559-81923581 CCTCATCCACAATGTCTCCAAGG + Exonic
1143741438 17:8956918-8956940 CCTCGCCCACATCCTCTGCTGGG - Intronic
1143993240 17:10985088-10985110 TGTCATCCACATTCTGTCCAAGG - Intergenic
1146398875 17:32488226-32488248 CTTCCTCTACATGCTCTGCAGGG + Exonic
1148087517 17:45003294-45003316 CCTCATTCAGACTCTGTGCAGGG - Intergenic
1148510215 17:48162468-48162490 CCTCATCCGTATTCTGAGCAAGG - Exonic
1148751809 17:49949510-49949532 TCTGATCCACATCCTCTGTAAGG + Intergenic
1149310992 17:55393512-55393534 CCTTTGCCACATTCTCTTCAGGG - Exonic
1152622896 17:81374056-81374078 CCTCTTCCCCCTGCTCTGCAGGG - Intergenic
1152843244 17:82583772-82583794 CCTCACCCACATACGCGGCACGG - Intronic
1154029983 18:10745161-10745183 CCTCTTCCACTGTCCCTGCAGGG - Intronic
1154326279 18:13393122-13393144 CCTCATCCCTCTCCTCTGCAAGG + Intronic
1155115658 18:22764219-22764241 CTTCATCCATGTTGTCTGCAAGG - Intergenic
1155881723 18:31157559-31157581 ACTCCTCCAGATTCACTGCAGGG + Exonic
1156482682 18:37445995-37446017 CCTCCTTCTCATTCTCTGTAAGG - Intronic
1157543611 18:48531613-48531635 CCTCATCCTCATCTTCAGCAGGG - Intergenic
1157551993 18:48588507-48588529 CCTCATCCACAGTCCCTGTCTGG + Intronic
1157984795 18:52424762-52424784 CCTGATACAGATTATCTGCATGG + Intronic
1161844209 19:6702565-6702587 CCTCATCCAGGTTACCTGCAGGG + Exonic
1162453736 19:10769873-10769895 CCTCTTTGAAATTCTCTGCAGGG - Intronic
1164645836 19:29858313-29858335 CCTCATCCAGCTTCTCAGAATGG - Intergenic
1164675965 19:30101709-30101731 CCTCATCCACTCACTCAGCATGG - Intergenic
1164712630 19:30368309-30368331 TCTCATCAGCATTCTCTGAATGG + Intronic
1164820989 19:31251179-31251201 CCTGAGCCCCATGCTCTGCAGGG + Intergenic
1165303832 19:34990818-34990840 TCTCGCCCACATTCTCTGTAAGG - Intergenic
1166365854 19:42278141-42278163 CATTCTCCACATTCTGTGCATGG + Intronic
1168187144 19:54707567-54707589 CCTCAACCACATTCTAGTCATGG + Intergenic
1168261943 19:55200288-55200310 CCTTGTACACATTCTCTGTATGG - Exonic
925455801 2:4015689-4015711 CCTCAGCCAGATGCTCAGCAAGG + Intergenic
926158885 2:10474340-10474362 CCACACCCACAACCTCTGCAGGG + Intergenic
926394401 2:12426266-12426288 CCTCCTCGTCAGTCTCTGCATGG + Intergenic
930046364 2:47176248-47176270 CCCCACCCCCATTCTCTTCAGGG - Intronic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
934568423 2:95353236-95353258 CCCCACCCAGGTTCTCTGCATGG - Intronic
934761276 2:96858304-96858326 CCTCATCCCCACACCCTGCAAGG - Intergenic
937771456 2:125725126-125725148 CCTCACACACAATCTCTGCAAGG - Intergenic
938944614 2:136200416-136200438 CCTCTTCCATATCTTCTGCAGGG + Intergenic
944877077 2:203973134-203973156 CCTCAACCACAGACTCTCCAGGG + Intergenic
945425414 2:209694672-209694694 CCTCAACCACAGTCTCTGATGGG - Exonic
946401667 2:219471763-219471785 CCTCACCCCCATCCACTGCAGGG - Intronic
947610709 2:231523562-231523584 CGTCCTCCACTTTCTCGGCAGGG + Exonic
948118864 2:235514190-235514212 CCACATCAACATTCTCTGAGAGG - Intronic
948137080 2:235644487-235644509 GCTCATCATCATTCTCTGCTTGG + Intronic
948411244 2:237762967-237762989 CCTCTCCCACATTCTCTGTGTGG - Exonic
948749882 2:240125465-240125487 CCTCATTGACTTTCTCTGGATGG + Intergenic
948910534 2:241000161-241000183 CACCATCCACATCCTCTGCATGG + Intronic
1169328437 20:4696864-4696886 CCTCACCCACCTTCTGTGCCTGG + Intronic
1169529890 20:6473782-6473804 CCAAATGCACATTCCCTGCATGG + Intergenic
1170237050 20:14118669-14118691 CTTCTTCCAAATTCTCTGGATGG + Intronic
1170470510 20:16663751-16663773 CATCATCCACATTCACTGAGTGG - Intergenic
1170745616 20:19095957-19095979 CCTCACTCACATGCCCTGCAGGG + Intergenic
1172632143 20:36385742-36385764 CCTCAGCCACCCTCTCTCCAGGG + Intronic
1174174697 20:48637382-48637404 CCTCTTCCCCACTCTCTGCTGGG + Intronic
1174671121 20:52308539-52308561 CCTCATTAACATACTCTGTATGG + Intergenic
1174739152 20:52995254-52995276 CCTCATTCAGAATCTCTACATGG + Intronic
1175440985 20:58991190-58991212 CCTCAGTCACACTCTCTGCCTGG + Intronic
1176198072 20:63846702-63846724 CCTCCTCCCCACTCCCTGCAGGG - Intergenic
1176901991 21:14453472-14453494 CCACATCCACACCCTATGCAAGG - Intergenic
1177794436 21:25758817-25758839 CCTCATCCAATTTCTTTACATGG - Intronic
1179786005 21:43730014-43730036 CCTCATCCCCCTTCTCGGGATGG - Intronic
1180007055 21:45027671-45027693 CCTCATCCACATGCCCTCCTGGG - Intergenic
1180622709 22:17172348-17172370 CCTCATCCAAGGTCTTTGCACGG + Intergenic
1182473487 22:30562714-30562736 CCTCATCCACATTCTCTGCACGG - Intronic
949454928 3:4228132-4228154 AGTCATCCACATAGTCTGCATGG - Intronic
952899177 3:38098255-38098277 CCTCCTCCCCACTCTCTGGAAGG + Intronic
953482885 3:43267052-43267074 CCTCATCTACCTTCTCTGAATGG + Intergenic
953721977 3:45364029-45364051 CATCATCTACATTCTCTACCAGG - Intergenic
954151733 3:48661290-48661312 CCTCCTCCACATTCTCGCGAAGG + Exonic
955709177 3:61760907-61760929 CTTCATTCACATCCTTTGCAGGG - Intronic
956073372 3:65478625-65478647 CCTCCTCCTCATTCTCCGCGTGG + Exonic
956442506 3:69294271-69294293 CCTCATCCACATTCTGAGCGGGG + Intronic
957544639 3:81621830-81621852 CCTCATTCACTTTCACTGGATGG + Intronic
959668248 3:108945008-108945030 CTTCATCCTCAGCCTCTGCATGG + Intronic
960846808 3:122011565-122011587 GCTCATTCACACTCTCTCCAGGG + Intronic
961355926 3:126340017-126340039 CCTCGTCCACATTCTCAGAAAGG - Intergenic
961828986 3:129613593-129613615 GCTCATGCACTTGCTCTGCAGGG - Intergenic
963110424 3:141683637-141683659 CCTCAACCACAGCCTCTGCGGGG - Intergenic
963252400 3:143115298-143115320 CTGCATCCTCATTCTTTGCAAGG + Intergenic
964514733 3:157495492-157495514 CTTCATTGACACTCTCTGCAAGG + Exonic
965277959 3:166711966-166711988 CTTGATCCACATTCTCCTCAGGG - Intergenic
965515093 3:169612912-169612934 CATCATCAAAATGCTCTGCAAGG + Intronic
965568941 3:170151809-170151831 CCACATCCACACTCCCTGTACGG + Intronic
966371966 3:179260167-179260189 CCTCTCCCACATTCTCTGTGTGG + Intronic
967221732 3:187253101-187253123 CCTCAGCCACTGCCTCTGCAAGG + Intronic
968829513 4:2925645-2925667 CCTCAGCCACCTGCTCAGCAGGG + Intronic
970681506 4:18513881-18513903 CCTCTTCCTAATTCTCTTCAGGG + Intergenic
971036493 4:22698909-22698931 GCTCATCCACATTGTCTCAAAGG - Intergenic
974159215 4:58115834-58115856 CATCATCCATATTCTCTAGATGG + Intergenic
974407910 4:61499371-61499393 ATACATTCACATTCTCTGCATGG + Intronic
978685431 4:111437136-111437158 CCTAATCCACATGCTGTTCAAGG + Intergenic
979266797 4:118712833-118712855 CCTAATCCCCATCCTCTGAAAGG - Exonic
979352105 4:119656045-119656067 TCTCCTCCTCATTCTCTGCCTGG + Intergenic
980651889 4:135727327-135727349 CATCATGCACATTATGTGCAAGG - Intergenic
980867143 4:138565103-138565125 CTTCATCCACAGCCTCTCCAAGG - Intergenic
984160189 4:176243233-176243255 TCACATCCACATTCTTTTCATGG - Intronic
984474159 4:180215826-180215848 CATCATCCACACTCTTTGGAGGG + Intergenic
985527402 5:413893-413915 CCTCAACCCCATTCTCTGCCTGG - Intronic
985732047 5:1554668-1554690 CCTCATCTTCCTTCTCTGCAAGG + Intergenic
988026445 5:25697634-25697656 CATTATCCACTTTCTCAGCATGG + Intergenic
988619116 5:32804369-32804391 CCTCATCCTCATTCTGTGTCTGG + Intergenic
989474412 5:41857539-41857561 CCTCACCCACATCCTCTTGATGG - Intronic
992526785 5:77619487-77619509 CCTCACCCCCATTATCTGAAAGG + Intronic
992640495 5:78764556-78764578 CCTCTTACACATTCCCTTCAAGG + Intronic
993133633 5:83929813-83929835 CCTCAGCCACTTTCACTGTAGGG - Intergenic
993279610 5:85908363-85908385 CCTCAGCCTCATATTCTGCATGG - Intergenic
993279780 5:85910244-85910266 CCTCAGCCTCATATTCTGCATGG + Intergenic
993307425 5:86289916-86289938 CCACATCTTCATTCTCTCCAAGG - Intergenic
995118377 5:108507678-108507700 TCTCATCCACACTGTCTGCCTGG + Intergenic
995429122 5:112054892-112054914 CCTCATGGACAATCTCTGCTAGG + Intergenic
996339342 5:122418914-122418936 CCTCTCCCACAGTCTCTGCAAGG - Intronic
996617414 5:125458084-125458106 CCTCATGGAGATTCTCTGCTAGG + Intergenic
996810608 5:127512753-127512775 CCTCTTCCATATCTTCTGCAGGG + Intergenic
997698477 5:135879915-135879937 ACTGACCCACACTCTCTGCAGGG - Intronic
998358730 5:141565635-141565657 CCTCATCCTCATTCTCAGTTGGG - Intronic
999821086 5:155229780-155229802 CTTCATCAACATTTACTGCATGG - Intergenic
1000495893 5:161984151-161984173 TCTCATACATATTCTCAGCATGG + Intergenic
1001136757 5:169108904-169108926 CCTCATCCACATGCTCTTTCAGG + Intronic
1003094501 6:3131808-3131830 CCTCAGCCACATCCTCTGCCAGG + Intronic
1005922992 6:30417379-30417401 TCTCATCCATATTATCTGCAAGG - Intergenic
1006205061 6:32333459-32333481 CCCCATACACATTACCTGCAGGG - Intronic
1006441662 6:34057177-34057199 CCTCCTCCACATGCTCTGCGTGG + Intronic
1008639704 6:53449301-53449323 CCTCATCCTCATTCTGTATATGG - Intergenic
1009931464 6:70181474-70181496 CCTCATTCCCATCCCCTGCAAGG + Intronic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1011901217 6:92301139-92301161 CCCCCTTCACATGCTCTGCAAGG + Intergenic
1013068906 6:106710470-106710492 CCTAATCCCCATTTTCAGCATGG + Intergenic
1013685637 6:112578313-112578335 CCTATCCCACGTTCTCTGCAAGG - Intergenic
1013965894 6:115954845-115954867 TCTCATCCCCTTTCTCTGCCAGG + Intronic
1014094703 6:117447149-117447171 CCTCATCCAGAGTCTCTGAGGGG - Intronic
1014382308 6:120757838-120757860 GCTCAGCAACATTCTATGCAAGG + Intergenic
1015526704 6:134181062-134181084 CCTCCTCTCCATTCTCTCCAAGG + Intronic
1018644650 6:165936303-165936325 CTTACTCCACATTCTCTCCATGG - Intronic
1019356798 7:584421-584443 CCTCTTCCCCATTCCCTGCGTGG - Intronic
1019629113 7:2037097-2037119 CCTGATCCACGTTTGCTGCATGG - Intronic
1020242335 7:6405372-6405394 TCTCATCGACATTCCCAGCATGG + Intergenic
1020724038 7:11786411-11786433 CCACTTCCACATTTTCTGCCTGG + Intronic
1022520077 7:31000531-31000553 CCCCGTCCACACCCTCTGCAGGG + Intergenic
1024232808 7:47375517-47375539 CCTCACCCACCTTCCCTGCAGGG + Intronic
1024345661 7:48310621-48310643 ACCCCTCCACATTCTCTCCAGGG - Intronic
1027858338 7:83541725-83541747 CCTCTTTCACTTTCTCTGAAAGG - Intronic
1030069993 7:105689965-105689987 CCTCATCATTATTCTCTGCAAGG + Intronic
1031251616 7:119390122-119390144 CTTCATCCACACGCTCTGCTGGG - Intergenic
1032500634 7:132397051-132397073 CACCACCCGCATTCTCTGCAGGG + Intronic
1034210588 7:149358949-149358971 CCTCATCCACCATCACTGCAGGG - Intergenic
1036003847 8:4639131-4639153 CTTCATCCACCTACTTTGCAGGG + Intronic
1041076878 8:54176859-54176881 GCTCATCCATATTCTAAGCAAGG - Intergenic
1043142674 8:76609334-76609356 TCTTCTCCACATTCTTTGCATGG - Intergenic
1045745698 8:105418451-105418473 CCTCACTCTCATTCTCTCCAAGG + Intronic
1046786464 8:118272075-118272097 CCTCATACAGAATCTCTGCTAGG - Intronic
1046965966 8:120166031-120166053 ACTGACCCTCATTCTCTGCAGGG - Intronic
1048317795 8:133375060-133375082 CATCATCCAAATCCTCTGCATGG + Intergenic
1048835918 8:138518756-138518778 CCTTTTCCACATATTCTGCAGGG + Intergenic
1050467288 9:5941001-5941023 CCTCATACCCAATCTCTACAAGG + Intronic
1051431167 9:16981940-16981962 CCTCTTCCAGTTTCTCTGCAAGG + Intergenic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1056170144 9:83977757-83977779 CCTCTTCCATATCTTCTGCAGGG + Exonic
1056297042 9:85203390-85203412 CCACATCCACATCCTCTAAAGGG - Intergenic
1057040105 9:91841864-91841886 TTTCCTCCACATTCTGTGCATGG + Intronic
1058814091 9:108667959-108667981 CCTCATCCACCTTTTCTGCTTGG - Intergenic
1061004017 9:127918239-127918261 CCACACCCACCTCCTCTGCAGGG + Intergenic
1062635632 9:137489108-137489130 CCTCCTCTGCTTTCTCTGCAGGG - Intronic
1186725445 X:12353318-12353340 ACTCAAACACTTTCTCTGCATGG + Intronic
1189234893 X:39479245-39479267 CCCCATCCACATGCACTGGAAGG + Intergenic
1192430665 X:71109390-71109412 CCTCATCCTCTTTCTCCTCAAGG - Exonic
1193485209 X:82078729-82078751 CCTCATGGAGAATCTCTGCAAGG - Intergenic
1194889026 X:99354502-99354524 CCCCATCTACCTTTTCTGCAGGG + Intergenic
1195340939 X:103905302-103905324 CCTTATCCCCATTCACTGAAGGG - Intergenic
1195942911 X:110180010-110180032 CCCCATCCTGTTTCTCTGCAGGG + Intronic
1196500508 X:116375699-116375721 CCTCATCTACATTATCAACAGGG + Intergenic
1196613734 X:117743422-117743444 ACTCTACCACAGTCTCTGCATGG - Intergenic
1197058943 X:122153968-122153990 CCTCATGGACATCCTCTGCTAGG + Intergenic
1197451319 X:126621901-126621923 CAAAATCCACATTATCTGCATGG - Intergenic
1198710157 X:139492798-139492820 CCTCATCCTCATTTCCTGCTAGG + Intergenic
1198851189 X:140966794-140966816 TCTCATCCCCATTCTCCCCAAGG - Intergenic
1199807352 X:151313406-151313428 CCACAGCCACCTTCTCTGAAAGG - Intergenic