ID: 1182474343

View in Genome Browser
Species Human (GRCh38)
Location 22:30568281-30568303
Sequence CTGTGCTGCCGTGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182474343_1182474350 29 Left 1182474343 22:30568281-30568303 CCCTTTTTTCCACGGCAGCACAG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1182474350 22:30568333-30568355 GTTCAGTGTCCTCACATAACTGG No data
1182474343_1182474351 30 Left 1182474343 22:30568281-30568303 CCCTTTTTTCCACGGCAGCACAG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1182474351 22:30568334-30568356 TTCAGTGTCCTCACATAACTGGG 0: 1
1: 0
2: 0
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182474343 Original CRISPR CTGTGCTGCCGTGGAAAAAA GGG (reversed) Intronic
900210981 1:1455773-1455795 CTGGGCTGCCGAGGAAGACAGGG - Exonic
903507481 1:23848259-23848281 CCATTCTGCAGTGGAAAAAATGG + Intronic
904328458 1:29742724-29742746 CTTTGCTTTCCTGGAAAAAAGGG + Intergenic
906847925 1:49214433-49214455 CTGTACTGCCGTGAAAGAACTGG - Intronic
911097790 1:94069374-94069396 CTGTGCTGACGTGGCATAAGAGG + Intronic
911877849 1:103191856-103191878 CTTTGCAGCAGTGGAAGAAATGG - Intergenic
913376934 1:118162860-118162882 ATGTGCTGCCCTAGAAATAAAGG - Intronic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
914577153 1:148983669-148983691 CTGTGCTCCTGTAGAGAAAATGG - Intronic
915788825 1:158645378-158645400 CGGTGCTCCTGTGGGAAAAAGGG + Exonic
916227207 1:162500401-162500423 CAGTGCCACCGTGTAAAAAAAGG + Intronic
924276474 1:242392557-242392579 CAGTGCTGCCATGGACAAGATGG - Intronic
924845650 1:247767323-247767345 CTGTGCAGCCATAGAAAAGAAGG - Intergenic
1063978519 10:11435759-11435781 CTGTGCGTGTGTGGAAAAAAGGG + Intergenic
1066258801 10:33708498-33708520 TTGTTCTGCAGTGGAAAAATGGG - Intergenic
1067170410 10:43901472-43901494 CTGTGGTGCAGTGGCAAACAGGG + Intergenic
1067453319 10:46395944-46395966 CAGTGCTGCAATGGAAGAAAAGG - Intergenic
1067583915 10:47463822-47463844 CAGTGCTGCAATGGAAGAAAAGG + Intronic
1067700637 10:48568866-48568888 CTGTGCAACCCTGGAAAACATGG - Intronic
1077123143 11:920068-920090 ATTTGCTGCCGTGGGAGAAATGG + Intergenic
1079213149 11:18481797-18481819 CAGTTCTGCTCTGGAAAAAATGG - Exonic
1081517146 11:43843940-43843962 CTGTGATGCCATGGAAAAGGTGG - Intronic
1083553822 11:63610158-63610180 CTGTGCTCCCATGGCAAAACTGG + Intronic
1084646518 11:70462008-70462030 CTGTGCTGCCAGGAACAAAATGG - Intergenic
1085517226 11:77118651-77118673 TTGTGCTGTTGTGGAAACAAGGG - Intronic
1086181280 11:83955203-83955225 CTGTGTTGCCGTTTATAAAAGGG - Intronic
1086316632 11:85601731-85601753 GAGTGCTGCCCTGGAAATAATGG - Intronic
1087296709 11:96385955-96385977 CTGTGCTGTGGTGGAAATATTGG - Intronic
1090295739 11:125586194-125586216 CTGTTTTGCGGGGGAAAAAAAGG + Intergenic
1092746668 12:11678846-11678868 CTGTGAGGCAGGGGAAAAAAAGG + Intronic
1094484726 12:30915436-30915458 GTGTGCTGTCGTGGAAAGAAAGG - Intergenic
1096628151 12:52907649-52907671 CTGGGCTGCCCCAGAAAAAAAGG - Intronic
1097464811 12:59908907-59908929 CTGTGTTGCAGTGGAGAAAGGGG + Intergenic
1099918874 12:88932210-88932232 TTTTGCTCCCGTGGAAACAAAGG - Intergenic
1101663040 12:106783979-106784001 CTATGCTGAGGGGGAAAAAAGGG - Exonic
1101898126 12:108770680-108770702 CTGGGGTGGGGTGGAAAAAACGG + Intergenic
1103762245 12:123259316-123259338 CTCTGGTGCCAGGGAAAAAATGG - Intergenic
1107088120 13:36447629-36447651 TTGGGCTGCCGTAGAACAAATGG + Intergenic
1109139499 13:58696500-58696522 ATAGGCTGCCGTGGAGAAAAGGG + Intergenic
1109348172 13:61143020-61143042 ATGTGCTGACATGGAAAAGAAGG + Intergenic
1112044446 13:95582116-95582138 CTGTGTTGCTGTGGGAAACACGG + Exonic
1113032092 13:106005112-106005134 CTGTGCAACAGTGGAAAAATTGG - Intergenic
1113375793 13:109764641-109764663 CTGTGCTGCCAGGGAAAGACAGG + Intronic
1113481609 13:110625864-110625886 CTGTGCTGCTCTGGAGACAAGGG + Intronic
1114065981 14:19060174-19060196 CTGTGCTGCCTGGGGAAGAAGGG + Intergenic
1114096287 14:19339851-19339873 CTGTGCTGCCTGGGGAAGAAGGG - Intergenic
1118795797 14:69142468-69142490 CTCTGCTTCTGTGGAAAAGAAGG - Intronic
1118863322 14:69682828-69682850 CAGGGCTGCAGGGGAAAAAAGGG - Intronic
1119444711 14:74653587-74653609 CTGTGCTGCCTTTGAAAAGCAGG + Intronic
1122782544 14:104149753-104149775 CTGTGCAGCCCTGGAGAGAAGGG + Intronic
1202852805 14_GL000225v1_random:31513-31535 CTGTGATGCCCAGGAAAGAATGG - Intergenic
1125416071 15:39453925-39453947 CTGTGCTGTCGTGCAAAGCAGGG - Intergenic
1127700439 15:61494788-61494810 CTGCCCTGCCCTGGAAAATAGGG - Intergenic
1127870854 15:63072483-63072505 CTGTGCTGCAGGGAGAAAAAAGG + Intergenic
1130842132 15:87710507-87710529 CTGTCCTACCCTGGAAACAAGGG + Intergenic
1131588450 15:93721440-93721462 CTATGCTTCTGTGGAAACAATGG - Intergenic
1132757922 16:1494911-1494933 CTGTGCTTCCCTGGAAAACCTGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136048792 16:27636172-27636194 CTCTTCTTCCCTGGAAAAAATGG + Intronic
1141406668 16:83800708-83800730 CTGTGCACCATTGGAAAAAAAGG - Intergenic
1158106809 18:53894832-53894854 CTGTGAGGCTGTGGAAAAAAAGG + Intergenic
1160513782 18:79467287-79467309 CTGTGCTGCCGTGGAAACGCGGG + Intronic
1164629408 19:29752363-29752385 CTGAGCTGCTGTGGCAATAATGG - Intergenic
1164824553 19:31274965-31274987 TAATGCTGCCGTAGAAAAAAGGG + Exonic
1166943805 19:46384781-46384803 CTGTCCTGCTGAGGAAAACATGG - Intronic
1167221705 19:48203550-48203572 CTGGGCTGCTTTGGGAAAAATGG - Intronic
926398312 2:12468468-12468490 CTCTGGTGCCATGGAACAAAGGG + Intergenic
927724012 2:25406771-25406793 GTGAGCTGCTGTGGAAAGAAGGG + Intronic
928593425 2:32839343-32839365 CTTGGCTGCCATGGAAAGAAGGG + Intergenic
931610437 2:64093426-64093448 TTGTGGTGCCTTTGAAAAAAGGG + Exonic
931881930 2:66577400-66577422 CGGTGCAGCCCTGGAGAAAAGGG + Intergenic
937009106 2:118545606-118545628 CTGTGCTGCCAAGGGAAAACAGG + Intergenic
939568021 2:143807816-143807838 ATGTGCTGCAGTTGAAAACAAGG - Intergenic
1168740182 20:182332-182354 AAGTGCTGCAGTGAAAAAAAGGG + Intergenic
1170987747 20:21274019-21274041 CTGTGCTGCCCTGGTCAGAAAGG + Intergenic
1171415142 20:24973295-24973317 CAGTGCTGCTGTGGAAAAGTAGG - Intronic
1171773743 20:29347215-29347237 CTGTGCTTCCTTGGAAGGAAGGG - Intergenic
1175003054 20:55650896-55650918 TTGGGCTGCAGTGGAAAGAATGG - Intergenic
1180055651 21:45357990-45358012 CAGTGCTGCCGTGTACGAAACGG - Intergenic
1180319207 22:11305331-11305353 CTGTGCTTCCTAGGAAGAAAGGG - Intergenic
1180484461 22:15782766-15782788 CTGTGCTGCCTGGGGAAGAAGGG + Intergenic
1181273599 22:21674938-21674960 CTGTGCAGCTCTGGACAAAAGGG - Intronic
1182372148 22:29818907-29818929 CTGGGCTGCTGGGGAAGAAAAGG - Intronic
1182474343 22:30568281-30568303 CTGTGCTGCCGTGGAAAAAAGGG - Intronic
955930673 3:64053765-64053787 CTGTGCTGCTGTGGTACACATGG + Intergenic
956632043 3:71326243-71326265 CAGTGCTGCAGTGCAAATAAAGG + Intronic
959334135 3:105042633-105042655 CTGTGATCCAGTGAAAAAAATGG + Intergenic
959425781 3:106186128-106186150 CTATGTGGCCGTGGAAAAATTGG - Intergenic
961479194 3:127168597-127168619 CTGTGCTGCCGGGGACAGCAGGG + Intergenic
961961462 3:130859646-130859668 CTGTGATGCTGTGGACAAGAAGG - Intronic
963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG + Intergenic
965630901 3:170731478-170731500 CTGTGATGCAGTGGAAAGACAGG + Intronic
967263176 3:187665248-187665270 CTGTCCTGGAGTGGAAAAAAAGG - Intergenic
967496592 3:190149323-190149345 CTGTGATGGCTTGGAAAAACAGG - Intergenic
967657740 3:192071975-192071997 CTGTGATGGCTTGGAAAAACAGG + Intergenic
967740835 3:193000508-193000530 CTGTGATGGCTTGGAAAAACAGG - Intergenic
970482310 4:16488548-16488570 CAATGCTGACGTGGAAAATATGG - Intergenic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
971045744 4:22803166-22803188 CTGTGCAGCCCTGGAAAGACAGG - Intergenic
972380491 4:38514972-38514994 CTGTGCTGCTGTGCAAATCAAGG - Intergenic
975206273 4:71647405-71647427 CTGTGCTGGTCTGAAAAAAAAGG + Intergenic
981214459 4:142148124-142148146 CTCTGCTACTGAGGAAAAAAAGG + Intronic
982438618 4:155406929-155406951 CTATGCTGCCTTGGGAAAGAGGG - Intergenic
988204875 5:28121451-28121473 CTGGGAGGCTGTGGAAAAAAGGG + Intergenic
990784284 5:59401785-59401807 CTGTGCTGCTCTGGAGAGAAAGG + Intronic
990835492 5:60014727-60014749 CTGTGCCACCTTGGAAGAAAAGG + Intronic
990981231 5:61604219-61604241 CTGTGTTGGCCTGGAAAAGAGGG - Intergenic
991131652 5:63129516-63129538 CTGTGATGACTTGGAAGAAATGG + Intergenic
992493197 5:77265999-77266021 CTGCGCTGCTCAGGAAAAAAGGG + Intronic
1002796531 6:475384-475406 ATATGCTGCCATGGAAAGAACGG + Intergenic
1007686207 6:43668722-43668744 AGGTGCTGCCCTGGAGAAAATGG - Intronic
1011918451 6:92540391-92540413 TTTTCCTGCCATGGAAAAAAAGG - Intergenic
1018387939 6:163321869-163321891 GGGTGCAGACGTGGAAAAAAAGG - Intergenic
1018475434 6:164135580-164135602 CTTTGCTGCTATGGAACAAATGG + Intergenic
1018845063 6:167550343-167550365 CTGTGCTTCCGTGGAAAGAAAGG + Intergenic
1019227045 6:170521833-170521855 CTGTGATGCTGTGGAGAAAAAGG + Intergenic
1020364417 7:7365320-7365342 CTGGCCTGCCTTGGAAAAGAAGG + Intronic
1020687197 7:11310496-11310518 CGGTGATGCTGTGGAGAAAAAGG - Intergenic
1021527936 7:21609770-21609792 CTGTGCTGCTGTAGTGAAAATGG + Intronic
1022413447 7:30157482-30157504 CAGTGCTGACGTGGAAGAAGAGG + Exonic
1024653999 7:51433950-51433972 CTGTGCTGCCATTGAAATAAGGG - Intergenic
1025015291 7:55434591-55434613 CAGTGCTGCTGTGAAAACAAAGG - Intergenic
1026918552 7:74138373-74138395 CTGTGCTGTGGGGGAAAAGACGG + Intergenic
1026997863 7:74630651-74630673 TTGTGCTGCCTTGGAAACCAAGG + Intergenic
1027531950 7:79345881-79345903 CTGTGCAACAGTGGAAATAATGG - Intronic
1030314798 7:108103656-108103678 CTCTGCTGCTGTGGAAAGAGGGG - Intronic
1032913378 7:136459542-136459564 GTGTTCTGCCCTGGAGAAAAGGG + Intergenic
1038045915 8:23765482-23765504 GTGAGCTGCCGAGGAAAGAAGGG + Intergenic
1039898127 8:41730772-41730794 CTGGGCTCCCATGGAAAAGAAGG + Intronic
1040631704 8:49220934-49220956 TTTTGCTGCTGTGGAAAAGAGGG + Intergenic
1041896844 8:62934822-62934844 TTGTGCTACTGGGGAAAAAACGG + Intronic
1047503545 8:125461005-125461027 CTGTGCTACGGTGGAAGAGATGG - Intergenic
1052946278 9:34170879-34170901 CTGTGCTGCAGTGGGAGCAAAGG - Intergenic
1056926694 9:90840332-90840354 CTGGGCTGCAGGGGAAACAATGG + Intronic
1057427827 9:94968073-94968095 CTTTGCTGCTGCGGAAAGAATGG + Intronic
1062303387 9:135888377-135888399 GTGTGCTGCCGTGGAAGAGCTGG - Intronic
1203519777 Un_GL000213v1:34603-34625 CTGCGCTGCCTGGGAAGAAAGGG - Intergenic
1190939081 X:55023730-55023752 GTTTGCTGAGGTGGAAAAAAAGG - Intronic
1192637863 X:72836900-72836922 CTGTTCTGCCATGTAAAAGAAGG + Intronic
1192643851 X:72883915-72883937 CTGTTCTGCCATGTAAAAGAAGG - Intronic
1194133414 X:90109871-90109893 CAGTGATGCCGTGGAGAAATAGG + Intergenic
1195265967 X:103180224-103180246 CTGAGCTGCTGTTGAAAAATTGG - Intergenic
1195438071 X:104868046-104868068 CTTTGCTGCAGTGTAAAAAATGG + Intronic
1195672911 X:107484253-107484275 CAGTGCTGCTGGGGAAGAAAGGG + Intergenic
1195688661 X:107606432-107606454 CTTTGCAGACATGGAAAAAAAGG - Intergenic
1196741124 X:119027052-119027074 CTGAGCTGCCGTGTAAAAGCTGG - Intergenic
1199683471 X:150243505-150243527 CTATGCTGTTGGGGAAAAAAGGG + Intergenic
1200479195 Y:3679974-3679996 CAGTGATGCCGTGGAGAAATAGG + Intergenic
1200841971 Y:7791548-7791570 CTGTGCTTCCTTGGATGAAAAGG + Intergenic