ID: 1182475702

View in Genome Browser
Species Human (GRCh38)
Location 22:30575221-30575243
Sequence AAAATGAGACAGGGCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182475702_1182475711 10 Left 1182475702 22:30575221-30575243 CCATCCAGGCCCTGTCTCATTTT No data
Right 1182475711 22:30575254-30575276 CCTTTCCTTCTTCACCCCAGAGG No data
1182475702_1182475717 29 Left 1182475702 22:30575221-30575243 CCATCCAGGCCCTGTCTCATTTT No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475702_1182475713 23 Left 1182475702 22:30575221-30575243 CCATCCAGGCCCTGTCTCATTTT No data
Right 1182475713 22:30575267-30575289 ACCCCAGAGGAGCAAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182475702 Original CRISPR AAAATGAGACAGGGCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr