ID: 1182475706

View in Genome Browser
Species Human (GRCh38)
Location 22:30575231-30575253
Sequence CCAGGCCTGGAAAATGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182475706_1182475713 13 Left 1182475706 22:30575231-30575253 CCTGTCTCATTTTCCAGGCCTGG No data
Right 1182475713 22:30575267-30575289 ACCCCAGAGGAGCAAGACCATGG No data
1182475706_1182475717 19 Left 1182475706 22:30575231-30575253 CCTGTCTCATTTTCCAGGCCTGG No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475706_1182475711 0 Left 1182475706 22:30575231-30575253 CCTGTCTCATTTTCCAGGCCTGG No data
Right 1182475711 22:30575254-30575276 CCTTTCCTTCTTCACCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182475706 Original CRISPR CCAGGCCTGGAAAATGAGAC AGG (reversed) Intergenic
No off target data available for this crispr