ID: 1182475709

View in Genome Browser
Species Human (GRCh38)
Location 22:30575249-30575271
Sequence GGGGTGAAGAAGGAAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182475709_1182475722 24 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475722 22:30575296-30575318 ACCAATGCCTGCCAGGGGCCAGG No data
1182475709_1182475713 -5 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475713 22:30575267-30575289 ACCCCAGAGGAGCAAGACCATGG No data
1182475709_1182475717 1 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475709_1182475720 18 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475720 22:30575290-30575312 ATGAGGACCAATGCCTGCCAGGG No data
1182475709_1182475721 19 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475721 22:30575291-30575313 TGAGGACCAATGCCTGCCAGGGG No data
1182475709_1182475719 17 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475719 22:30575289-30575311 GATGAGGACCAATGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182475709 Original CRISPR GGGGTGAAGAAGGAAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr