ID: 1182475712

View in Genome Browser
Species Human (GRCh38)
Location 22:30575259-30575281
Sequence TTGCTCCTCTGGGGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182475712_1182475720 8 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475720 22:30575290-30575312 ATGAGGACCAATGCCTGCCAGGG No data
1182475712_1182475719 7 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475719 22:30575289-30575311 GATGAGGACCAATGCCTGCCAGG No data
1182475712_1182475717 -9 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475712_1182475721 9 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475721 22:30575291-30575313 TGAGGACCAATGCCTGCCAGGGG No data
1182475712_1182475722 14 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475722 22:30575296-30575318 ACCAATGCCTGCCAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182475712 Original CRISPR TTGCTCCTCTGGGGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr