ID: 1182475717

View in Genome Browser
Species Human (GRCh38)
Location 22:30575273-30575295
Sequence GAGGAGCAAGACCATGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182475701_1182475717 30 Left 1182475701 22:30575220-30575242 CCCATCCAGGCCCTGTCTCATTT No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475706_1182475717 19 Left 1182475706 22:30575231-30575253 CCTGTCTCATTTTCCAGGCCTGG No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475703_1182475717 25 Left 1182475703 22:30575225-30575247 CCAGGCCCTGTCTCATTTTCCAG No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475712_1182475717 -9 Left 1182475712 22:30575259-30575281 CCTTCTTCACCCCAGAGGAGCAA No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475709_1182475717 1 Left 1182475709 22:30575249-30575271 CCTGGCCTTTCCTTCTTCACCCC No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475705_1182475717 20 Left 1182475705 22:30575230-30575252 CCCTGTCTCATTTTCCAGGCCTG No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475702_1182475717 29 Left 1182475702 22:30575221-30575243 CCATCCAGGCCCTGTCTCATTTT No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475710_1182475717 -4 Left 1182475710 22:30575254-30575276 CCTTTCCTTCTTCACCCCAGAGG No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data
1182475708_1182475717 6 Left 1182475708 22:30575244-30575266 CCAGGCCTGGCCTTTCCTTCTTC No data
Right 1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182475717 Original CRISPR GAGGAGCAAGACCATGGATG AGG Intergenic
No off target data available for this crispr