ID: 1182476643

View in Genome Browser
Species Human (GRCh38)
Location 22:30580164-30580186
Sequence TCCCCACCAAAACTCCTACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182476636_1182476643 9 Left 1182476636 22:30580132-30580154 CCCCAATGCACAAAGATTTGTCC 0: 1
1: 0
2: 1
3: 18
4: 138
Right 1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1182476637_1182476643 8 Left 1182476637 22:30580133-30580155 CCCAATGCACAAAGATTTGTCCC 0: 1
1: 0
2: 2
3: 20
4: 158
Right 1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1182476638_1182476643 7 Left 1182476638 22:30580134-30580156 CCAATGCACAAAGATTTGTCCCA 0: 1
1: 1
2: 0
3: 14
4: 164
Right 1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182476643 Original CRISPR TCCCCACCAAAACTCCTACA GGG Exonic
900948964 1:5846825-5846847 TCCCCACCCACACTACTCCAGGG - Intergenic
901830610 1:11889791-11889813 TGCCAACCCAAACACCTACAGGG + Intergenic
902372949 1:16016944-16016966 TCCCCACCCAAACTCCCCCAGGG - Intronic
905954586 1:41981579-41981601 TCCCCACCCCATCTCCTCCAAGG + Intronic
910728073 1:90359788-90359810 TCCCCGGCAAAACCCCTTCAGGG + Intergenic
912391305 1:109305048-109305070 CCCCCACCAAAGATCCTTCAGGG - Intronic
912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG + Intronic
913233685 1:116762801-116762823 TCCCCACCAAAAGTACTACCAGG + Intronic
916587978 1:166165353-166165375 TCCCCACCAGAACTGGTCCAGGG + Intronic
924534702 1:244925049-244925071 TCCCCACCACAACGCACACATGG - Intergenic
1064288588 10:14013562-14013584 TCCCCAGCAAAAAACCCACAAGG + Intronic
1064781872 10:18849472-18849494 TCCCAATCAAAATTCCAACAAGG - Intergenic
1065538417 10:26736933-26736955 TCCCCAGCATAACACCTACATGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1073044190 10:100626666-100626688 TCCACACCAAAACTTGTAGAGGG + Intergenic
1073075583 10:100824144-100824166 ACCCCACCATCACCCCTACAGGG - Intronic
1074099375 10:110342363-110342385 TCCCACCCAAAACTTCTTCAGGG - Intergenic
1075616493 10:123893663-123893685 TCCCCACCCACCCTCCTCCATGG + Intronic
1076181353 10:128411307-128411329 ACACCACCAAAAGTCCTAAAGGG - Intergenic
1076564600 10:131389568-131389590 TCCCCAACAAAACTCATCCAGGG + Intergenic
1076768089 10:132647698-132647720 TCCCCACCCACCCTCCTCCAAGG - Intronic
1084187672 11:67483457-67483479 CCCCCACCAATGCTGCTACAAGG - Intronic
1084604136 11:70162607-70162629 CCCCCACCACCACTCCTGCAAGG + Intronic
1089067464 11:115672699-115672721 TCCTCACCAACACACCTCCACGG - Intergenic
1090306754 11:125697941-125697963 TCCCCACCTCAACTCCTACCAGG + Intergenic
1092729279 12:11513057-11513079 TCCCCTGGAAAACTACTACATGG + Intergenic
1094035084 12:26061232-26061254 TACACACCAAAACTCAAACAAGG - Intronic
1099306252 12:80959679-80959701 TTCACACAAAAACTCATACATGG - Intronic
1099847926 12:88052946-88052968 TCCCCAGCAGAAGTCCAACAAGG - Intronic
1099927123 12:89031958-89031980 TCCCAAACAAAGTTCCTACATGG + Intergenic
1100011140 12:89954601-89954623 TCCTTATGAAAACTCCTACAAGG - Intergenic
1101759962 12:107650409-107650431 TCCCCACCCAAACACACACATGG + Intronic
1102307115 12:111813490-111813512 TCCCAACAAAAACTTGTACACGG + Intergenic
1105651104 13:22379031-22379053 GCCCTACCAAAACCACTACAAGG + Intergenic
1106205775 13:27592908-27592930 TCTCCACCAAAACTCTATCAAGG - Intronic
1107550677 13:41472083-41472105 TCCACACAAAAACTAATACATGG - Intergenic
1108363204 13:49686337-49686359 CCACCACCAAACCTCCTGCAGGG + Intronic
1111305755 13:86410338-86410360 TCCCCACAAAACCTCATCCAAGG + Intergenic
1111862865 13:93730207-93730229 TCTCTCCCAAAACTCCTACCAGG + Intronic
1113526241 13:110980117-110980139 TCCACATTAAAACTCCTGCAAGG - Intergenic
1114343748 14:21773142-21773164 TCCTTACCAAAACCCCTCCATGG + Intergenic
1120084462 14:80254213-80254235 TCCCCACATAAACTCATGCATGG - Intronic
1120157307 14:81107628-81107650 TGCCCACCAAACCTCTTCCATGG + Intronic
1122298540 14:100718949-100718971 TCCCCCTCAAACCTCCTCCAGGG - Intergenic
1122480187 14:102042158-102042180 TGCCCACCACAAATCCTGCAGGG - Intronic
1122763380 14:104047034-104047056 TCCCTACCACAATTCCAACAAGG - Intronic
1124031045 15:26012187-26012209 TGGCCACCAGAGCTCCTACATGG + Intergenic
1124235906 15:27989273-27989295 CTCCCACTGAAACTCCTACATGG + Intronic
1124472894 15:30003903-30003925 TCACCTCCTAAACTCCTAAACGG + Intergenic
1125389156 15:39172970-39172992 TCCCCACAGAAACCTCTACATGG + Intergenic
1125469920 15:39992845-39992867 TCCCCACAAAACCTCTTACCTGG - Exonic
1131036499 15:89225940-89225962 TCCCCACCAAACCTCCCAGCTGG - Intergenic
1131910827 15:97199000-97199022 GCACCACCAAAACTCCAAGAAGG + Intergenic
1139015292 16:62683000-62683022 ATCCAACCAACACTCCTACAAGG - Intergenic
1142393581 16:89817843-89817865 CCCCCACAAAGACTCCTGCACGG + Intergenic
1144255071 17:13459505-13459527 TCCCCACCAAAACTTATTCTTGG + Intergenic
1144748059 17:17628846-17628868 TCCAAACCAAAACTCCCACTGGG - Intergenic
1145378724 17:22375454-22375476 CCCCCACCCACAGTCCTACAGGG - Intergenic
1146470154 17:33117734-33117756 TCCCAAACAAATCTACTACATGG - Intronic
1146674165 17:34761395-34761417 TCCCCACACACACCCCTACAAGG + Intergenic
1149702530 17:58667351-58667373 TCTTCACAAAAACTCCTCCAAGG - Intronic
1150362587 17:64549890-64549912 TCTCCAACAAAGCTTCTACAGGG + Intronic
1150906624 17:69345182-69345204 TCCCCACCCAAATTCCTATGTGG - Intergenic
1151099976 17:71545430-71545452 TCCCCACCTGTACCCCTACAGGG - Intergenic
1153992516 18:10413003-10413025 TCCCCACAAAAAGTGTTACATGG + Intergenic
1157116920 18:44870666-44870688 TCCACACCTACACTCATACATGG + Intronic
1158633619 18:59137665-59137687 TCCACACAAAAACCCGTACACGG - Intergenic
1159272978 18:66176737-66176759 TCCACACCAAAAGTCTTCCAGGG - Intergenic
1159324761 18:66900493-66900515 TTCCCTCCAAAAATCCTACCAGG - Intergenic
1160934347 19:1586179-1586201 TCCACACCATCACTTCTACACGG + Intronic
1163427573 19:17247525-17247547 TCCCCACCAAAGATCCTAGCAGG - Intronic
1167624866 19:50581152-50581174 ACCCCACCAACAATCCTGCAAGG + Intergenic
925288477 2:2730901-2730923 TCCCTTCCAAAGCTCCTTCAAGG + Intergenic
926352722 2:12011456-12011478 TCCTCACCAGAAGTCCTAGATGG - Intergenic
929318952 2:40516600-40516622 TCCACACAAAAACTTGTACATGG - Intronic
929431463 2:41890886-41890908 TCCCATTAAAAACTCCTACACGG + Intergenic
931088647 2:58862491-58862513 TTCCCACCTCAACTCCTACATGG - Intergenic
931821631 2:65957660-65957682 TCCCCACCCAAACCCCTGCTGGG - Intergenic
932506563 2:72238368-72238390 TCCATACCAAAACTTATACATGG - Intronic
933161965 2:79035415-79035437 TCTCCACCAAAAGTACTAAATGG - Intergenic
934945266 2:98536702-98536724 TTCCCACCAAAACCCTGACATGG + Intronic
937371274 2:121299215-121299237 TCCCCACCAGAATTGCTAGAAGG - Intergenic
938596054 2:132788143-132788165 TCCCCACCATCACTCCCACGGGG - Intronic
939841969 2:147200282-147200304 TCCCAACCAAAACTCCTGCCTGG - Intergenic
940005337 2:149005074-149005096 TCCTCACAAAAATTCCTACTGGG - Intronic
940592696 2:155749218-155749240 TCCCCACAAAACCTCATCCAAGG + Intergenic
943002035 2:182340284-182340306 TCACCACCATAACTTCTGCATGG + Intronic
946828585 2:223704806-223704828 TTACCACCAAGAGTCCTACAAGG + Intergenic
947167438 2:227276750-227276772 CCCCCACCAAAACTCCAGAACGG - Intronic
947299344 2:228671453-228671475 TCCTCACAAAACCTCATACATGG - Intergenic
1168737889 20:159454-159476 TCCCTACCAAACCTCATCCATGG - Intergenic
1171195157 20:23191303-23191325 TCCAGAATAAAACTCCTACATGG + Intergenic
1172853287 20:37982075-37982097 TCTCCACCAAAAAACTTACAAGG + Intergenic
1173605543 20:44328393-44328415 TCCCAATCAAAATTCCAACAAGG - Intergenic
1175369090 20:58475002-58475024 TCCCCAGCAATTCTCCTAGATGG + Intronic
1175786225 20:61713315-61713337 TCCCCCCCAGACCTCCTGCAAGG + Intronic
1178041448 21:28644391-28644413 TCCCCACCCAAAATCTTACCTGG - Intergenic
1180595219 22:16968539-16968561 TCCCTACCACAACTCCTCCTGGG + Intronic
1181274830 22:21681787-21681809 TCCCTGCCAGAACTCCTCCAGGG - Intronic
1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG + Exonic
1185265068 22:49897288-49897310 TCCACACAAAAGCTCGTACAAGG - Intergenic
950069121 3:10137821-10137843 TCACCCCCAAAACTCCTTCATGG - Intergenic
950869618 3:16217549-16217571 TCCACCCCAAAACCCCCACAAGG + Intronic
951714939 3:25631908-25631930 TCCCCACCAAAATTCCAAAGAGG + Intronic
952874982 3:37937248-37937270 TCCCCACCAAAGCTCATATTGGG + Intronic
953697216 3:45169508-45169530 TCCCCACCTAGACCCCTGCAAGG - Intergenic
954784055 3:53080394-53080416 TACCCGCCAAAGCTCCTGCAGGG + Intronic
963507960 3:146211040-146211062 TCCACACTAAAACTTGTACATGG - Intronic
965858455 3:173117735-173117757 TCCTGCCCAAAACTCCTGCAGGG + Exonic
966505074 3:180691812-180691834 TCCCCATGAACACTCCTCCATGG + Intronic
967309829 3:188095365-188095387 ACCCCAACAAAACTATTACATGG + Intergenic
970388811 4:15585985-15586007 TCCTCACCAAACATCCTATATGG - Intronic
975365058 4:73519501-73519523 TGCCCACCAGAACTGCTAAAAGG - Intergenic
977586192 4:98778123-98778145 TCCCCACCAAAACTCATGTTTGG - Intergenic
979794102 4:124823130-124823152 TTCCCACTAAACCACCTACATGG - Intergenic
980019785 4:127695021-127695043 TCCCAATCAAAATTCCAACAAGG - Intronic
980194023 4:129564831-129564853 TCCCAACCAAAATTCCTAAAAGG - Intergenic
985320412 4:188704328-188704350 TCCACACAGAAACTCATACATGG - Intergenic
989277708 5:39609003-39609025 TCTCTTCCAAAATTCCTACAGGG - Intergenic
995980214 5:118092948-118092970 CATCCACCAAAACTCATACAAGG + Intergenic
997362445 5:133303653-133303675 ACCCCACCACCACTACTACAAGG - Intronic
998524598 5:142831020-142831042 TCCCCACAAACACTCCTACAGGG - Intronic
998571869 5:143267454-143267476 TCCACACAAAAACATCTACAGGG - Intergenic
999325755 5:150642396-150642418 TCCCCACCTAAACTTCTGCAGGG - Intronic
1000015812 5:157274534-157274556 TCCACACAAAAACTTGTACATGG - Intronic
1007466078 6:42052208-42052230 TCCCCAACAAAAGTCCTTAAGGG - Intronic
1007687269 6:43674237-43674259 TCCCCACCAGAACTCAGGCATGG - Intronic
1008185609 6:48387021-48387043 GCCCCACAAAAAATGCTACAAGG - Intergenic
1011160322 6:84382107-84382129 TCCCCAGCAAAACTTCACCACGG + Intergenic
1013015886 6:106160232-106160254 TCCCCAAGAAAATTCCTTCAAGG - Intergenic
1013560485 6:111298885-111298907 TCCTTACCAAAACTTCTTCAGGG - Intergenic
1014864129 6:126506531-126506553 TCCCCACCAAAACCCATCCAAGG + Intergenic
1018644251 6:165932887-165932909 TCCCCTCCACAACCCCTCCAAGG + Intronic
1021122771 7:16815700-16815722 TCACCACCAAAAATACTACCTGG - Intronic
1021884179 7:25122212-25122234 TCCCCACCAGAACTCAGACTAGG + Exonic
1023096362 7:36663763-36663785 TCCCCACAAAAACTTGCACAAGG - Intronic
1026525560 7:71150453-71150475 GGCCCACCAAAACTCCTACGGGG + Intronic
1029195013 7:98799261-98799283 TCCCAACAAACACTCCTCCAGGG - Intergenic
1032888083 7:136163743-136163765 TCGCCTCCAAGACTCTTACACGG - Intergenic
1035028120 7:155839883-155839905 TCCTCACCAAAGCCTCTACACGG - Intergenic
1035294094 7:157858083-157858105 TCACCACCCACACTCCTGCAGGG + Intronic
1035294113 7:157858150-157858172 TCACCACCCACACTCCTGCAGGG + Intronic
1035294227 7:157858556-157858578 TCACCACCCACACTCCTGCAGGG + Intronic
1035294279 7:157858728-157858750 TCACCACCCACACTCCTGCAGGG + Intronic
1035294309 7:157858830-157858852 TCACCACCCACACTCCTGCAGGG + Intronic
1035294340 7:157858932-157858954 TCACCACCCACACTCCTGCAGGG + Intronic
1035294359 7:157858999-157859021 TCACCACCCACACTCCTGCAGGG + Intronic
1035294473 7:157859405-157859427 TCACCACCCACACTCCTGCAGGG + Intronic
1035294548 7:157859647-157859669 TCACCACCCACACTCCTGCAGGG + Intronic
1035444376 7:158929767-158929789 TTCCCTCTAAAACTACTACAAGG - Intronic
1036075916 8:5499493-5499515 TCCTCACCAAAACTAACACAGGG - Intergenic
1036776662 8:11617580-11617602 TCCCCACCAAGCCTCCTCCGTGG + Intergenic
1038591868 8:28846495-28846517 TCCCCACTAATACTCCTAGTAGG - Intronic
1040055511 8:43054073-43054095 TCCCTACCAAAACTCATTCAGGG - Intronic
1043467446 8:80526207-80526229 TCTACATCAAAACTCCAACAGGG - Exonic
1046414498 8:113894450-113894472 TGCCCACACAACCTCCTACATGG + Intergenic
1046766999 8:118080479-118080501 TCTCCACCAGAACTTCTTCAGGG - Intronic
1048306811 8:133290186-133290208 GCCCCGCCACAACTCCCACAGGG + Intronic
1049021990 8:139963488-139963510 TCCCTCCAAAAGCTCCTACATGG - Intronic
1055147497 9:72954294-72954316 TCCACAAGAGAACTCCTACATGG + Intronic
1058705117 9:107631445-107631467 TCCCCACCCCCACTTCTACAAGG + Intergenic
1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG + Intronic
1060976101 9:127766130-127766152 TCCCCACCCCTTCTCCTACAGGG - Intronic
1061047209 9:128172603-128172625 TCCCCAGCAGAGCTCTTACAGGG - Intronic
1189802269 X:44702391-44702413 TCCACACAAAAACTTGTACATGG - Intergenic
1193194640 X:78617831-78617853 TTCCTACCAAAAATGCTACAGGG - Intergenic
1194900559 X:99504707-99504729 TCCACACCACACCTCCAACATGG + Intergenic
1194968337 X:100315362-100315384 ACCCCACCAAAAAACCAACAGGG + Intronic
1196352920 X:114754251-114754273 TTCCTACCAAAACTCCAAAAAGG + Intronic
1199870838 X:151897140-151897162 TCCCCACAAAAACTTTTACTTGG + Intergenic