ID: 1182476650

View in Genome Browser
Species Human (GRCh38)
Location 22:30580178-30580200
Sequence TGGGCTCTCCCTGTCCCTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182476650_1182476657 26 Left 1182476650 22:30580178-30580200 CCTACAGGGACAGGGAGAGCCCA 0: 1
1: 0
2: 5
3: 29
4: 333
Right 1182476657 22:30580227-30580249 GTCCTGAGACTCAGCTCCCTGGG 0: 1
1: 0
2: 2
3: 28
4: 209
1182476650_1182476656 25 Left 1182476650 22:30580178-30580200 CCTACAGGGACAGGGAGAGCCCA 0: 1
1: 0
2: 5
3: 29
4: 333
Right 1182476656 22:30580226-30580248 TGTCCTGAGACTCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 35
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182476650 Original CRISPR TGGGCTCTCCCTGTCCCTGT AGG (reversed) Exonic