ID: 1182477056

View in Genome Browser
Species Human (GRCh38)
Location 22:30582081-30582103
Sequence CTTTGCTGCATGTCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182477049_1182477056 30 Left 1182477049 22:30582028-30582050 CCACTTTCCGACCTGGCCAGAGC 0: 1
1: 0
2: 2
3: 13
4: 202
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477054_1182477056 2 Left 1182477054 22:30582056-30582078 CCTTCTACATCACCTAGTCTACA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477053_1182477056 6 Left 1182477053 22:30582052-30582074 CCTGCCTTCTACATCACCTAGTC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477051_1182477056 19 Left 1182477051 22:30582039-30582061 CCTGGCCAGAGCTCCTGCCTTCT 0: 1
1: 0
2: 6
3: 60
4: 522
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477052_1182477056 14 Left 1182477052 22:30582044-30582066 CCAGAGCTCCTGCCTTCTACATC 0: 1
1: 0
2: 0
3: 45
4: 289
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477055_1182477056 -10 Left 1182477055 22:30582068-30582090 CCTAGTCTACAATCTTTGCTGCA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277
1182477050_1182477056 23 Left 1182477050 22:30582035-30582057 CCGACCTGGCCAGAGCTCCTGCC 0: 1
1: 0
2: 1
3: 41
4: 532
Right 1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG 0: 1
1: 0
2: 4
3: 39
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182477056 Original CRISPR CTTTGCTGCATGTCTGCTGC TGG Intronic
901066749 1:6497815-6497837 TCTTGCTGCATGTCCTCTGCTGG + Intronic
901364221 1:8731722-8731744 CTGTGCTTCATGTTTGCTGTGGG - Intronic
902936122 1:19766072-19766094 ATTTGCTGAATGTCTTCTGACGG - Intronic
902954659 1:19917309-19917331 CTCTTTTGCAAGTCTGCTGCTGG + Intergenic
903327595 1:22579915-22579937 CTTTCCTGCCTGCCTGCTGGGGG - Intronic
903924919 1:26825486-26825508 TTTTGCTGGGTGTCTGCTGGAGG - Intergenic
906273111 1:44496957-44496979 CTGTGCTGCCTGCCTCCTGCTGG + Intronic
913122333 1:115753603-115753625 CTGTGCTGCGTGACTGCCGCTGG + Intronic
915649198 1:157295101-157295123 CTCTGCTGCAGGTTTGCTGGAGG - Intergenic
915864115 1:159479554-159479576 CTTTGAAGCATGTCTGCATCAGG - Intergenic
917915327 1:179695224-179695246 CTCTGCTGCAGATCTGCTGGAGG - Intergenic
919842575 1:201619873-201619895 CTTTGCTGCCCTTCTTCTGCTGG + Intergenic
921336519 1:214092512-214092534 TTTTGCTGCATGATTGATGCTGG - Intergenic
922502041 1:226104444-226104466 CTTTGCTTCTTGTATGCTCCAGG - Intergenic
1063338094 10:5235656-5235678 CTCTGCTGCAGGTCTGCTGGAGG - Intergenic
1065641051 10:27783112-27783134 CTTTGCTGCCTGTTGGCTGGGGG + Intergenic
1067743509 10:48914766-48914788 CTTTTCTGCATGGCTACTGTTGG - Intronic
1067938261 10:50629888-50629910 CTTTGCTGCAGCTCTGAGGCAGG - Intergenic
1068158511 10:53233336-53233358 CTTTGTAGTATGTTTGCTGCAGG + Intergenic
1068885176 10:62090928-62090950 TTTTTCTTCATGTCTGCTGCTGG - Exonic
1069352437 10:67544876-67544898 CTCTGATGCATGAATGCTGCTGG - Intronic
1069636864 10:69930286-69930308 CTTTGGTGCTTGTCTGGGGCAGG - Intronic
1069896487 10:71683384-71683406 CTCTCCAGCATGTCTGCTCCAGG - Intronic
1070627650 10:78062569-78062591 CTTGGGGACATGTCTGCTGCTGG + Intergenic
1070751696 10:78967809-78967831 CTTTCCTGCATGTGGGCTGTGGG - Intergenic
1070775200 10:79105642-79105664 TTTTGCTGCCTGCCTGCTGGAGG - Intronic
1070779720 10:79130433-79130455 CCTGGCTGCAGCTCTGCTGCAGG - Intronic
1071738717 10:88332061-88332083 CTTGGCTGCGTGTCTACTGCTGG + Intronic
1071939554 10:90573620-90573642 CTTTGGAGCATATCTGCTGAAGG + Intergenic
1072724161 10:97801327-97801349 GCTTGCTGCATGGCTGCTACTGG - Intergenic
1075479805 10:122770069-122770091 CATTGCTGCATAAGTGCTGCTGG - Intergenic
1076049269 10:127319835-127319857 CTTTGCTCCATGCGTGCTTCTGG + Intronic
1076102492 10:127794250-127794272 CTCTGCTGCTTTTCTGCTGGTGG - Intergenic
1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG + Intronic
1076397316 10:130149695-130149717 CTTTGTTGGGTGCCTGCTGCTGG + Intronic
1077379929 11:2227119-2227141 CTTTGCAGCATGGATGCAGCTGG + Intergenic
1077696539 11:4397744-4397766 CTCTGCTACAGGTCTGCTGGAGG - Intergenic
1077787843 11:5403798-5403820 CTTTTCTGCATTCCTGCTCCAGG - Intronic
1079682704 11:23318735-23318757 CTTTGCTGACTGTCAGCTGGAGG + Intergenic
1080126336 11:28738592-28738614 TTTACCTGCCTGTCTGCTGCTGG - Intergenic
1081804445 11:45882838-45882860 TTTTCCTGCCTGTCTGCTGCTGG + Exonic
1083535884 11:63466275-63466297 ATGTGCTGCATGGCTGCTCCTGG - Exonic
1084931390 11:72559289-72559311 CTTTAGTGCAGGCCTGCTGCTGG - Intergenic
1085498115 11:76991470-76991492 CTTTTCTCCAGGTCAGCTGCAGG + Intronic
1085683695 11:78602700-78602722 CTCTGCTGCAGGTCTGCTGGAGG + Intergenic
1087703699 11:101466039-101466061 CTCTGCTACAAGTCTGCTGGAGG + Intronic
1088754568 11:112875198-112875220 CCTTGCTGCCTTTCTTCTGCTGG - Intergenic
1089765929 11:120765718-120765740 CTCTTCTGCAAGTCTGCTGGAGG + Intronic
1089835159 11:121363938-121363960 ATTTGCTGTGTGTCTGCTCCTGG + Intergenic
1090441003 11:126725693-126725715 CCTCGCTGCAAGGCTGCTGCTGG + Intronic
1090680757 11:129055005-129055027 TTTTGGTCCATGTGTGCTGCAGG - Intronic
1091958860 12:4673104-4673126 CTCTGCTGCAGGTCTGCTGGAGG - Intronic
1092560843 12:9611218-9611240 CTCAGCTGCAGGTCTGCTGGAGG - Intergenic
1092587116 12:9911006-9911028 GTGTGCTGCATGGCTGATGCAGG - Intronic
1092752303 12:11730208-11730230 CTTTGCTGAAGGCCTGCTGCTGG - Intronic
1094233356 12:28134615-28134637 CTTTGCTGCATACTTCCTGCAGG - Intronic
1094274105 12:28649612-28649634 CTTTTGTGGGTGTCTGCTGCAGG + Intergenic
1095488590 12:42709066-42709088 CTCTGCTGCAGGTCTGCTGGAGG - Intergenic
1095860134 12:46907755-46907777 CTGTGCTGTAAGACTGCTGCAGG - Intergenic
1096321767 12:50620403-50620425 TCTTTCTGTATGTCTGCTGCTGG + Intronic
1097138938 12:56883162-56883184 CTTAGCTGGATGTGTGTTGCAGG - Intergenic
1097460577 12:59857011-59857033 CTCTGCTGCAAGTTTGCTGAAGG - Intergenic
1097714962 12:62956013-62956035 CCATGCTGCATGGCTGCTGCAGG + Intergenic
1098683082 12:73382565-73382587 TTTTGCTGCCTGTCAGCTGCAGG + Intergenic
1098886822 12:75968965-75968987 CCGTGCTGCTTCTCTGCTGCTGG - Intergenic
1101519638 12:105469412-105469434 ATATTCTGCTTGTCTGCTGCTGG + Intergenic
1102473661 12:113174936-113174958 CTTTCCCCCATGTCTCCTGCAGG - Exonic
1104015362 12:124958264-124958286 CTTACCTGCGTGCCTGCTGCAGG - Intronic
1104837373 12:131800249-131800271 ATTTGCTGCTTGTCTGCTGTAGG + Intergenic
1105355214 13:19653304-19653326 CTCTGCTGCAGGTTTGCTGGAGG - Intronic
1107441134 13:40428397-40428419 CATTTCTGCATGGCTTCTGCTGG + Intergenic
1107651449 13:42549325-42549347 CTTTGCTGGATGTCTAAGGCAGG - Intergenic
1112086842 13:96041057-96041079 CTTTGCTCCAGAACTGCTGCAGG + Intronic
1113070671 13:106417691-106417713 CTTTGCTGCGTGTCAACTCCTGG + Intergenic
1113237776 13:108300289-108300311 ATTTGCTGCATGTCTACTGTGGG + Intronic
1115162245 14:30409716-30409738 CTCTGCTGCAGGTCTGCTGGAGG + Intergenic
1116547339 14:46185106-46185128 CTCTGCTGCCTGTCAGCTGGTGG - Intergenic
1117367525 14:55044205-55044227 CTGTTCTGCATATATGCTGCAGG - Exonic
1117583793 14:57179504-57179526 CTGTGCTGGATGTCCACTGCTGG + Intergenic
1119539798 14:75430379-75430401 CTTTTCTGCCTTTCTGCTGCAGG + Intronic
1120922534 14:89767890-89767912 CATTGCTGAATGTCTTCTGTGGG - Intergenic
1121096481 14:91221107-91221129 CTCTGCTCCATCTCTGCTCCAGG + Intronic
1121579297 14:95014768-95014790 CTTTGCTGCATGGCTAGTGGAGG - Intergenic
1121936109 14:98020474-98020496 CTTGGATGTATGTCTTCTGCTGG + Intergenic
1122049314 14:99044364-99044386 TTTTGCTGCATGTCTGACACTGG - Intergenic
1125794730 15:42395755-42395777 CTTTGCTGCATCCCTCCTCCTGG + Intronic
1126066787 15:44831870-44831892 CTGGGCTGCATGTGGGCTGCAGG - Intergenic
1126093044 15:45068685-45068707 CTGGGCTGCATGTGGGCTGCAGG + Intronic
1126361422 15:47850301-47850323 CTTTTCTGCATGTTTGTAGCAGG + Intergenic
1126500435 15:49339390-49339412 CTCTGCTGCAGGTCTGCTGTAGG + Intronic
1127482684 15:59391806-59391828 CTTTGCTTCATGTCAGGAGCTGG - Intronic
1128336300 15:66787741-66787763 CTTTGCTGCATTGCTGAGGCTGG - Intergenic
1131298547 15:91173722-91173744 CTTTCCTGCATTTCTTCTGTGGG - Intronic
1132223747 15:100124879-100124901 CTTTGCTGCTTCTCTGCTCTGGG - Intronic
1132615754 16:840462-840484 CCTTGCTGCAGCTCTGCTTCTGG + Intergenic
1133105976 16:3509717-3509739 CTGAGCTCCAAGTCTGCTGCAGG + Intronic
1133288875 16:4704806-4704828 CTTAGCTACATTTCTGCTGCAGG + Intronic
1135971320 16:27074011-27074033 CTTTCCTGCCTGCCTGCTCCAGG - Intergenic
1136044626 16:27605733-27605755 CTTTGTTGCTTGGCTTCTGCTGG + Intronic
1136629791 16:31483220-31483242 CATTGCTGCATATTTCCTGCTGG + Exonic
1137239337 16:46641387-46641409 CTCTGCTGCAGGTCTGCTGCAGG - Intergenic
1137666297 16:50251656-50251678 CGTTGCTGCATGGCAGCTACCGG + Intronic
1137696073 16:50463011-50463033 CCAGGCTGCAGGTCTGCTGCAGG - Intergenic
1138674669 16:58642405-58642427 CTCTGCTCCCTGCCTGCTGCTGG - Intergenic
1139005046 16:62559534-62559556 CTGTGCCACATGGCTGCTGCTGG + Intergenic
1139313338 16:66045366-66045388 CTTTGCTATCTGTCTGCTGTGGG - Intergenic
1139949737 16:70663141-70663163 CTGGGCTGGATGTCTGCTGGGGG - Exonic
1140051720 16:71487300-71487322 CTTTGCTGTCTCTCTCCTGCTGG + Intronic
1141057030 16:80827246-80827268 ATTTGCAGCATATGTGCTGCTGG + Intergenic
1142523561 17:521729-521751 CTTTGCTCCACAGCTGCTGCTGG - Exonic
1147316636 17:39624005-39624027 CATTGCTGGATGCCTGCCGCGGG - Intergenic
1148045040 17:44738305-44738327 ATTTCCTGCATGTGTGGTGCAGG + Intronic
1149402497 17:56312608-56312630 CTTTGCTACCTGTCGCCTGCTGG + Intronic
1151882060 17:76901907-76901929 CATTACTGCATGTGTGCTGAAGG - Intronic
1152168209 17:78724599-78724621 CATTGCTGAATGTCCCCTGCGGG + Intronic
1153170335 18:2308978-2309000 CTTTACTGAATGCCTGTTGCAGG + Intergenic
1155273680 18:24165727-24165749 CTTTGCTACATGTCTCCTTGGGG + Intronic
1155616368 18:27726008-27726030 CTTTCCTCCATGACTGCTGGTGG + Intergenic
1157528700 18:48404798-48404820 ATTTGCTGAATGAATGCTGCGGG - Intronic
1158543841 18:58379245-58379267 CTTTGCTGGATTTCTGCCTCCGG + Intronic
1158700243 18:59738688-59738710 ATTTGCAGCATGGTTGCTGCTGG - Intergenic
1159100812 18:63956045-63956067 CTTTGGTGCTGGTCTGCTACAGG - Intronic
1160585537 18:79911556-79911578 CTCTGCAGCATGGCAGCTGCAGG + Intronic
1160781784 19:880617-880639 CTTTGCAGCCTCTCTACTGCAGG - Intronic
1162522699 19:11191395-11191417 CTGTGCAGAATGTCAGCTGCTGG - Intronic
1163302584 19:16457360-16457382 CCTGGGTGTATGTCTGCTGCTGG - Intronic
1163687774 19:18721883-18721905 CTTGGCAGAATGTCTGCTGTGGG - Intronic
1167645538 19:50703290-50703312 GTTAGCTGGATGTCTGCTCCAGG - Intronic
1167814319 19:51866404-51866426 CTTTGCTGGCTGTCAGCTGGGGG - Intronic
1168291944 19:55361405-55361427 CTCACCTGCATGTCTGCTGATGG + Exonic
925530179 2:4850600-4850622 CTGTGCAGCACGTCTGCTGGAGG + Intergenic
925783947 2:7410188-7410210 TTTTGCCACATTTCTGCTGCAGG + Intergenic
927404607 2:22753103-22753125 CATTGCTGAATGTCTGCTATAGG + Intergenic
927527357 2:23757718-23757740 CTTTCCTGGAGGTCTGCTCCGGG + Exonic
931060724 2:58526352-58526374 CTTTGCTGCTTGTGTGCCCCTGG - Intergenic
931886614 2:66625247-66625269 CTCTTCTGCAGGTCTGCTGGAGG + Intergenic
932280655 2:70489145-70489167 CTGTGCTGCCTGTCTGTTCCTGG + Intronic
932511707 2:72299796-72299818 CTCTGCTGCAGGTCTGGTGGAGG + Intronic
933431239 2:82182610-82182632 TGTTGCTGCATTTCTGTTGCTGG - Intergenic
936401077 2:112164885-112164907 CTCTGTTGCATGCCTGCTGCAGG - Intronic
936511411 2:113150461-113150483 CTGTGCCACATGGCTGCTGCTGG + Intergenic
936888029 2:117336203-117336225 ATTTGCTGAAGGTCTGTTGCAGG + Intergenic
937204541 2:120227044-120227066 CTTTGCTGAATGTCCTCTGAGGG + Intergenic
938191140 2:129281882-129281904 CTGTGCTCCCTGTCTCCTGCAGG + Intergenic
938614279 2:132981307-132981329 ATTTGCTGCATGCCTTCTGTGGG - Intronic
940934486 2:159475808-159475830 CTCTGCTACAGGTCTGCTGGAGG + Intronic
940946612 2:159624566-159624588 CTCTGCTGCAGGTCTGCTGGAGG - Intergenic
942092099 2:172502495-172502517 ATTTCCTGCATGTCTCCTACAGG + Intronic
942124615 2:172810895-172810917 CTTTTCTCCAGGTCTGCTTCTGG - Intronic
943817726 2:192277404-192277426 AATTCCTGGATGTCTGCTGCAGG - Intergenic
943983943 2:194594990-194595012 CTTTTCTCCATGTCTGCTTGTGG + Intergenic
947043383 2:225949634-225949656 TTGTGCTGCAGGCCTGCTGCCGG - Intergenic
948204711 2:236157068-236157090 CTTCGCTGCAGGCCTGCTGGAGG + Intergenic
948723115 2:239913617-239913639 CTTTCCTGCATGTATGCGTCAGG + Intronic
1168815478 20:733880-733902 ACCTGCTGCATGGCTGCTGCAGG + Intergenic
1169188575 20:3641805-3641827 CTTTTGTGCAGGTCTGCTGGTGG - Intronic
1169451169 20:5712577-5712599 CTTTAATGCATGTTTGCTGGTGG + Intergenic
1169540957 20:6599164-6599186 CTTGGCTGCATGTCTATTGCAGG - Intergenic
1169601810 20:7269661-7269683 CTCTGTTGCAGGTGTGCTGCCGG + Intergenic
1169779337 20:9292682-9292704 CCCTGCTGCCTGCCTGCTGCAGG - Intronic
1171417925 20:24996070-24996092 CTTTGGTGGATGTCTGTTTCTGG - Intergenic
1172127482 20:32633543-32633565 ATTTGTTGTATGTCTGCTGTGGG - Intergenic
1173962949 20:47089180-47089202 CTTTGCTGGGTGTCTCCTCCTGG - Intronic
1174416471 20:50370528-50370550 CTTTGCTGAATGTCTCCTGGGGG - Intergenic
1176112943 20:63418757-63418779 CTTTGCTGCTTGTGTGCTTCTGG - Intronic
1176133738 20:63509396-63509418 CTTTGCTGACTGGCTGCTTCTGG + Intergenic
1176511854 21:7754729-7754751 CTTTGCTGCTTGCTTGCGGCTGG - Intronic
1178645967 21:34385255-34385277 CTTTGCTGCTTGCTTGCGGCTGG - Intronic
1180065990 21:45412687-45412709 CTGTGGTGCAGGTCTGCTGAGGG + Intronic
1181019123 22:20089335-20089357 CTTTGCTGCCTGTCTGGTTGTGG - Intronic
1182312068 22:29416329-29416351 CTTTCCTGCATCACTGCTGCAGG + Intronic
1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG + Intronic
1184522462 22:45003171-45003193 CTTTGCTCCAGGCCTACTGCAGG + Intronic
1185164879 22:49255400-49255422 CTTCGCTGGGGGTCTGCTGCCGG - Intergenic
949175948 3:1063043-1063065 CTCTGCTGCAGATCTGCTGGTGG + Intergenic
950157953 3:10738067-10738089 CTTTGCCGCATTACTGGTGCAGG - Intergenic
950763988 3:15259803-15259825 CTTTCCTTCCTGTCTTCTGCAGG - Exonic
951222148 3:20079813-20079835 CTTGGCTGGATGTCCACTGCTGG + Intronic
952179832 3:30906151-30906173 TTTTTCTGCATGTCCCCTGCCGG - Intergenic
952305450 3:32142090-32142112 CTTTGCAGCATGGATGCAGCTGG - Intronic
952447498 3:33396225-33396247 CTGTGCTGCTTGGCTGCTCCCGG + Exonic
952758143 3:36890365-36890387 CTGTGGTGCATTCCTGCTGCAGG - Intronic
952838408 3:37624398-37624420 CTCTTCTCCATCTCTGCTGCTGG + Intronic
953731904 3:45457073-45457095 CTTTGCTGCCTGTAGGCTGCAGG + Intronic
954481658 3:50805784-50805806 CCTGGGTGCATGTCTGCTGGAGG + Intronic
954581475 3:51705468-51705490 CTGTGCAGCTTGTTTGCTGCAGG + Intergenic
954775267 3:53011521-53011543 CCTTCCTGCTGGTCTGCTGCTGG - Intronic
954795408 3:53159055-53159077 CATTGCCAAATGTCTGCTGCAGG - Intronic
954861315 3:53693172-53693194 CTGTGTTTCATGACTGCTGCTGG + Intronic
954903733 3:54042128-54042150 CTTTGCTGCAAGTCTCCTCCTGG + Intergenic
959451344 3:106506870-106506892 CTTTCCTGCAGGTCTTCTGGAGG + Intergenic
959702202 3:109309138-109309160 CTTGGGTGAATATCTGCTGCTGG - Intronic
961026635 3:123564206-123564228 ATTTCCTGGATGTCTGCTCCTGG - Intronic
961403083 3:126660764-126660786 CGTTCCTGCAGGTCTGCTGAGGG - Intergenic
961453129 3:127011498-127011520 CCTTGCAGCATGGCTGCTGCTGG - Intronic
962361562 3:134747616-134747638 CTTTTCTGCTTCTCTGCTTCAGG + Intronic
962494037 3:135921746-135921768 CTTTGCTGACTGTCAGCTGGGGG + Intergenic
963061479 3:141230547-141230569 CTTTGCTGCCTGTCCGCCTCTGG - Intronic
963366569 3:144343139-144343161 CTTGGCTGGATTTCTGCTGCAGG + Intergenic
964305854 3:155338853-155338875 CTTCGTTGCATGTATTCTGCAGG + Intergenic
964894025 3:161572815-161572837 GTTTACTGTATGACTGCTGCAGG - Intergenic
964964160 3:162469701-162469723 CTTTGCTTCATGTGTGCCACTGG - Intergenic
965415310 3:168385206-168385228 CTGTGCTACAGGGCTGCTGCTGG + Intergenic
965867141 3:173217643-173217665 CTGTGCCACATGGCTGCTGCAGG + Intergenic
967079479 3:186036175-186036197 CTTTGCTGGCTGTCAGCTGAAGG - Intergenic
968565032 4:1307627-1307649 CTGGGGTGCAGGTCTGCTGCGGG - Intronic
969625856 4:8305289-8305311 TTTTACTGCAGGCCTGCTGCGGG - Intronic
970262737 4:14245501-14245523 CCTTGCTGGTTGTCAGCTGCAGG - Intergenic
970913321 4:21304500-21304522 CTCTGCTCCCTGTCTGCAGCAGG - Intronic
971272346 4:25161677-25161699 CTCTGCTGCAAGCCTGCTGTCGG + Intronic
971296748 4:25400605-25400627 CATGGCTGCAGGTCTGCTGCAGG + Intronic
973763126 4:54139229-54139251 CTGTGCTACATGGCCGCTGCTGG - Intronic
974354722 4:60797423-60797445 CTGTGCTCCAAGTCTGCTGTGGG - Intergenic
976061158 4:81130256-81130278 CTCTGTTGCAGGTCTGCTGGAGG + Intronic
978313372 4:107410164-107410186 CTCTGCTGTAGGTCTGCTGGAGG - Intergenic
980806378 4:137820057-137820079 GTTTGCTGCAAGTCTACTGTGGG + Intergenic
981016206 4:139977095-139977117 TCTTGCTGCATGTCTCCTGGTGG - Intronic
981155163 4:141426523-141426545 CTTTGCTTTTTGTCTGATGCTGG + Intergenic
981424854 4:144591475-144591497 CTTTCCTCATTGTCTGCTGCTGG - Intergenic
981981030 4:150791533-150791555 CTTTTCTTTATGTCTGCTTCTGG - Intronic
982319909 4:154067205-154067227 CTTGGGTGCATGTCTGCTAGGGG + Intergenic
983323326 4:166223698-166223720 CTTTTCTGCAAGTGTGCTCCTGG + Intergenic
984598074 4:181694249-181694271 TTTGGCTCCAGGTCTGCTGCTGG + Intergenic
986125475 5:4879582-4879604 CATTGCTGTGTGGCTGCTGCTGG - Intergenic
986378732 5:7162070-7162092 CTCTGCTGCACGTTTGCTGGAGG + Intergenic
986507999 5:8473135-8473157 CTTGGCTCCATGCTTGCTGCTGG + Intergenic
986666758 5:10111387-10111409 GTTTGTTGCATGTCTGCTCGTGG + Intergenic
989550178 5:42726053-42726075 CTTGGCTCCAAGTGTGCTGCTGG + Intergenic
992995591 5:82329345-82329367 CTTTTCTTCATGTCTACTGTTGG + Intronic
993810000 5:92464238-92464260 TTTGGCTGCATCTCTGCTGAAGG + Intergenic
994659902 5:102641306-102641328 TCATGCTGCATGTCTGCTGCTGG - Intergenic
995675205 5:114655319-114655341 CTTTACCACATGTCTGCTGTGGG - Intergenic
997161554 5:131614467-131614489 CTTTGCTGTCTCTCTCCTGCTGG - Intronic
998166710 5:139848452-139848474 CTGCGCTGCATGTCTGCGCCGGG + Exonic
998516253 5:142757122-142757144 ATTTGCTGAATGCCTTCTGCAGG - Intergenic
999481747 5:151954781-151954803 CTTAAATGCATGTCTGCTGATGG + Intergenic
999608094 5:153338725-153338747 CTCTGCTGCAGGTTTGCTGGAGG + Intergenic
1000985207 5:167858688-167858710 CTCTGCTTCATATCTGCAGCTGG - Intronic
1003187147 6:3841829-3841851 CTTTCCAGGATGACTGCTGCAGG - Intergenic
1010676544 6:78752860-78752882 CTGTGCTGCATGGCTGCTGCTGG - Intergenic
1010953645 6:82066469-82066491 CTTTGCTGGCTGTCAGCTGAGGG + Intergenic
1011151772 6:84281816-84281838 CTTTGCAGCTTGCCTGTTGCTGG - Intergenic
1011298842 6:85853140-85853162 CTGTGTTGCATATCTGCTGTAGG + Intergenic
1011437094 6:87350118-87350140 CTTTACTGTATGTAGGCTGCTGG - Intronic
1012057121 6:94427197-94427219 CTGTGCAACATGGCTGCTGCTGG + Intergenic
1013828831 6:114248620-114248642 ATTTATTGCATGTCTGCTGTGGG + Intronic
1014177880 6:118349979-118350001 CTTTGTTGAATTTCTACTGCAGG - Intergenic
1014791819 6:125681318-125681340 CTTTGGTGCATGTCTGTTAGAGG - Intergenic
1016356748 6:143226901-143226923 CTGGGCTGCATGTCGGCTGCGGG - Intronic
1017225172 6:152012907-152012929 TTTTGCTGCAACTCTGCTCCAGG - Intronic
1018421690 6:163645614-163645636 CTCTGCTGTATTTCTGCAGCCGG + Intergenic
1018563685 6:165128937-165128959 CTTTCCTGCTTGTCTTCTTCAGG - Intergenic
1020572036 7:9875790-9875812 TTTTGCTGCATGTAAGCTGAAGG + Intergenic
1020694138 7:11393261-11393283 CTCTGCTGCAGGTCTGCTGGAGG - Intronic
1022487642 7:30791959-30791981 CTGGGCTGCATGTGGGCTGCGGG + Intronic
1023492988 7:40764014-40764036 CTCTGCTGTATATATGCTGCAGG - Intronic
1023520932 7:41049376-41049398 ATTTTCTGAGTGTCTGCTGCGGG + Intergenic
1023715740 7:43042427-43042449 ATTTGTTACTTGTCTGCTGCTGG - Intergenic
1025254166 7:57372227-57372249 CTTTGCCGAATGTCTCCTGGGGG + Intergenic
1027427382 7:78075215-78075237 CGTTGCTGCATTTTTGTTGCTGG + Intronic
1030246293 7:107387354-107387376 CGCTGCTGCTTTTCTGCTGCTGG - Intronic
1030251211 7:107447117-107447139 CCTTGCTGCCTGTCAGCTGGGGG + Intronic
1032711462 7:134463835-134463857 CCTGGGTGCATGTCTGCTGGGGG - Intergenic
1032883358 7:136114097-136114119 CTCTGCTGCAGGTCTGCTGAAGG + Intergenic
1033341866 7:140498412-140498434 TTTGGCTTCATGGCTGCTGCTGG + Intergenic
1034299375 7:150001807-150001829 CCTTTCTGCATGCATGCTGCAGG - Intergenic
1034302431 7:150028594-150028616 CTTAGCGGCATCTCTGCTTCTGG + Intergenic
1034689047 7:152999494-152999516 CTCTGCTGCAGGTTTGCTGGAGG + Intergenic
1034803629 7:154068723-154068745 CTTAGCGGCATCTCTGCTTCTGG - Intronic
1034806636 7:154094966-154094988 CCTTTCTGCATGCATGCTGCAGG + Intronic
1036553872 8:9839546-9839568 CTCTGCTGCACATCTGCTGGAGG - Intergenic
1037930830 8:22879251-22879273 CATTGCGACATGTCTGCTTCTGG + Intronic
1038782361 8:30579168-30579190 CTGTGCCCCATGTGTGCTGCTGG - Intronic
1039299453 8:36193914-36193936 CTTTCCTGCAGGTCAGGTGCTGG + Intergenic
1041042454 8:53861222-53861244 CTTTGCAGAATGTCTGGTGGTGG - Intronic
1041459639 8:58097826-58097848 CTCTGCTACAGGTCTGCTGGAGG + Intronic
1041712775 8:60909097-60909119 GTTTCCTGGATTTCTGCTGCAGG - Intergenic
1041915857 8:63138091-63138113 CTTTTCTGCTAGGCTGCTGCTGG + Intergenic
1042773747 8:72406039-72406061 CTCTTCTGCAGGTCTGCTGCAGG - Intergenic
1043723067 8:83572261-83572283 TTTTGTTGCATGTTTCCTGCTGG - Intergenic
1044342429 8:91062163-91062185 ATTTGGTGCATGTCTTCTGCAGG - Intergenic
1045682279 8:104675596-104675618 CTTTGCAGCATGGATGCAGCTGG + Intronic
1050267548 9:3906655-3906677 CCTTGCTGCATTTCTGCCTCAGG + Intronic
1050576754 9:7004859-7004881 ATTTTCTGGATGGCTGCTGCGGG + Intronic
1051075380 9:13227419-13227441 CTGAGCTGCGTGTCTTCTGCTGG - Intronic
1051335046 9:16058403-16058425 GTATGCTGCAGGTATGCTGCAGG + Intronic
1051686087 9:19659477-19659499 GTGTGCTGCATGTTTTCTGCTGG + Intronic
1053028934 9:34758009-34758031 TTTTGGTGTATGTCTGCTGAGGG + Intergenic
1054459868 9:65456832-65456854 CTCTCCTGCATGTCTCCAGCGGG - Intergenic
1056516660 9:87358754-87358776 CTGTGCCACATGGCTGCTGCTGG - Intergenic
1056967972 9:91180052-91180074 CTTTGCTGTCTTTCTGCTTCTGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060272237 9:122152938-122152960 CTTTGCTGAGTTTCTGCTGCTGG + Intronic
1060537254 9:124400122-124400144 GTTTGCTGCATGGGTGCGGCAGG - Intronic
1186043058 X:5502740-5502762 CTTTTCTACATGTCCCCTGCAGG - Intergenic
1186694440 X:12015038-12015060 CTTTGCTGCATTTCTGTAACTGG + Intergenic
1186867274 X:13733244-13733266 CTTTGATGCATCTCAGCTACAGG + Intronic
1187112574 X:16316659-16316681 CTTTGCTCCACGTCTCCTGGGGG - Intergenic
1187728961 X:22234057-22234079 CTCTGCTGCAGGTCTGCTGGAGG + Intronic
1189018448 X:37309053-37309075 CATTGCTGCATTTTTGTTGCTGG - Intergenic
1192477726 X:71458004-71458026 CTTTGGTGCATTTCTGCTTCAGG + Intronic
1192741111 X:73893399-73893421 CTCTGCTGCAGGTCTGCTGTAGG - Intergenic
1192839311 X:74837145-74837167 CTGTGCTGCATGGCTGCTGCTGG + Intronic
1193650147 X:84122192-84122214 CCTCACTGCATGGCTGCTGCTGG - Intronic
1193675560 X:84447936-84447958 CTGTGCTGCAGCTCTGCTACTGG - Intronic
1193830106 X:86279414-86279436 CTCTGCTGCAGGTCTGCTGGAGG - Intronic
1194021356 X:88695410-88695432 CTCTGCTGCAGGTCTGCTGCAGG - Intergenic
1194386567 X:93262883-93262905 CTGGGCTGCATGTGTCCTGCAGG - Intergenic
1194597699 X:95879134-95879156 TTTTGCTGGTTGTCTGCTGAAGG - Intergenic
1195093814 X:101487609-101487631 TCTGCCTGCATGTCTGCTGCAGG + Intronic
1195810531 X:108824479-108824501 CTCTGCTGCAGGTCTGCTGGAGG + Intergenic
1197375875 X:125681691-125681713 TTGTGCTGCAAGGCTGCTGCTGG - Intergenic
1199005603 X:142693016-142693038 CTGTGCCACATGGCTGCTGCCGG - Intergenic
1199194891 X:145016563-145016585 CTTTGCTGCTAGCTTGCTGCTGG - Intergenic
1199838836 X:151622986-151623008 CTTTGCTGCATGTGTTCCTCAGG + Exonic
1201479260 Y:14420254-14420276 CTTTCTTGCATGTCTTCTGTAGG + Intergenic
1201591319 Y:15617665-15617687 CTCTTCTGCAAGTCTGCTGGAGG - Intergenic
1201760906 Y:17537130-17537152 CTGTGCTGTGTGGCTGCTGCTGG + Intergenic
1201776095 Y:17667840-17667862 CTTTGCTGGAAGTCTACTCCAGG + Intergenic
1201825461 Y:18238152-18238174 CTTTGCTGGAAGTCTACTCCAGG - Intergenic
1201840646 Y:18368860-18368882 CTGTGCTGTGTGGCTGCTGCTGG - Intergenic