ID: 1182477389

View in Genome Browser
Species Human (GRCh38)
Location 22:30583539-30583561
Sequence GCTTCTAGTGCCCCGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182477389_1182477395 0 Left 1182477389 22:30583539-30583561 CCCACCTGCGGGGCACTAGAAGC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1182477395 22:30583562-30583584 TCCATGAGAGGGCAAAACCAGGG No data
1182477389_1182477397 13 Left 1182477389 22:30583539-30583561 CCCACCTGCGGGGCACTAGAAGC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1182477397 22:30583575-30583597 AAAACCAGGGTTTCTCTCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 187
1182477389_1182477394 -1 Left 1182477389 22:30583539-30583561 CCCACCTGCGGGGCACTAGAAGC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1182477394 22:30583561-30583583 CTCCATGAGAGGGCAAAACCAGG 0: 1
1: 0
2: 2
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182477389 Original CRISPR GCTTCTAGTGCCCCGCAGGT GGG (reversed) Intronic
906509838 1:46404722-46404744 GCCTCAGGTGCCCCCCAGGTAGG - Intronic
907260651 1:53216052-53216074 CCTTCTTGTGCCCTGCAGGCTGG - Exonic
917443916 1:175090888-175090910 GCTGCTAGTGTCCAGCAGTTGGG + Intronic
917797339 1:178541920-178541942 GCTTCTACACCCCCGCAGGGAGG + Intronic
919068804 1:192727590-192727612 TCTTCCAGTGCCCCCCAGGAAGG + Intergenic
1068688450 10:59892480-59892502 GCTCCCTGTGCACCGCAGGTTGG - Intronic
1070849205 10:79549950-79549972 GCTCCTTGTGCCCCTCATGTTGG - Intergenic
1070924647 10:80211140-80211162 GCTCCTCGTGCCCCTCATGTTGG + Intergenic
1075873543 10:125788616-125788638 GCTTCCTGTGCCCAGCAGGAAGG - Exonic
1076515873 10:131044165-131044187 GCATCTAGTGCTCCCCAGGAGGG - Intergenic
1076515891 10:131044238-131044260 GCATCTAGTGCTCCCCAGGAGGG - Intergenic
1076515961 10:131044515-131044537 GCTTCCAGTGCTCCCCAGGAGGG - Intergenic
1077052415 11:573263-573285 GCATCTAGTGTCCAGCAGGCAGG + Intergenic
1077364534 11:2156189-2156211 GATTCTAGGGGCTCGCAGGTGGG + Intronic
1078817741 11:14844009-14844031 GCTACAAATGCCCCTCAGGTAGG + Exonic
1087786546 11:102361247-102361269 GCTTCTAGTGCCTCAGATGTGGG + Intronic
1087892142 11:103547655-103547677 GCTTCCAGAGCCCTGCAGGAGGG + Intergenic
1101263620 12:103061086-103061108 GCTTCTGGTTCCTCTCAGGTGGG + Intergenic
1102068198 12:109996236-109996258 GCCTCTAGTTCCCCGCAGGTGGG - Intronic
1108458838 13:50644691-50644713 CCTTCTAGTGGCCTGCAGGCTGG + Intronic
1109326088 13:60869719-60869741 GCTTTCTGTGTCCCGCAGGTGGG + Intergenic
1110361579 13:74631188-74631210 GATTCTTGTGCACCTCAGGTAGG + Intergenic
1112250189 13:97772202-97772224 GCTTCTGGTCCCCCCGAGGTGGG + Intergenic
1127283133 15:57509194-57509216 GCTTCTAGTACCTCTCAGCTGGG + Intronic
1128356555 15:66931584-66931606 GCTTCTAGTGCCCAGCAGACTGG + Intergenic
1134182851 16:12061629-12061651 GCTCCTACAGCCCAGCAGGTGGG + Exonic
1136299053 16:29321078-29321100 CCTCCTACTGCCCCTCAGGTAGG + Intergenic
1140981262 16:80112000-80112022 GCTTCTCTTGACCCGCAGGGAGG + Intergenic
1143854171 17:9836267-9836289 GCTTCCAGTGCCAGGAAGGTGGG + Intronic
1145295912 17:21592732-21592754 GCTGCTCCTGCCCCGCAGGTGGG + Intergenic
1145296092 17:21593569-21593591 GCTGCTTCTGCCCCGCAGGTGGG - Intergenic
1145367699 17:22278492-22278514 GCTGCTCCTGCTCCGCAGGTGGG + Intergenic
1145367873 17:22279330-22279352 GCTGCTCCTGCCCCGCAGGTGGG - Intergenic
1149531820 17:57401815-57401837 GCTGCTAGAGGCCTGCAGGTTGG + Intronic
1151477485 17:74352323-74352345 GCCTCCAGGGCCCTGCAGGTGGG + Exonic
1168032124 19:53688866-53688888 GCTACTAGTGACACGGAGGTGGG - Intergenic
926980770 2:18565312-18565334 GCTTCTAGTCCTCTGCATGTTGG + Intronic
929095787 2:38262245-38262267 GCCCCTAGTGCCCTGCAGCTGGG - Intergenic
931101637 2:59008472-59008494 GCTTCTAGTACCCAGCAATTTGG + Intergenic
935934188 2:108163984-108164006 GCTTCTAGTGCCAGAAAGGTAGG - Intergenic
938236811 2:129712101-129712123 GCTTCTAGTGCCCGGGAGGCTGG - Intergenic
948405659 2:237716925-237716947 GCTGCATGTGGCCCGCAGGTTGG - Intronic
1177911255 21:27035431-27035453 GCTTCAAGTGTCCCACAGGCTGG - Intergenic
1179953804 21:44726962-44726984 GCTCATGGTGCCCAGCAGGTGGG - Intergenic
1182477389 22:30583539-30583561 GCTTCTAGTGCCCCGCAGGTGGG - Intronic
1183197112 22:36361122-36361144 GCTGCCAGTGCCCAGGAGGTAGG + Intronic
953474498 3:43194201-43194223 GGTTCTACTGCCCGGCAGGCAGG - Intergenic
967837650 3:193978147-193978169 GCTTCTAGCACCCCTCAGGATGG + Intergenic
968914656 4:3492195-3492217 GCTTCTCATCCCCCGCAGGGAGG + Intronic
969977041 4:11114281-11114303 GCTTCTAGTTAACAGCAGGTGGG - Intergenic
973226124 4:47786674-47786696 GCTTTTAATGTCCCACAGGTAGG - Intronic
976432293 4:84976480-84976502 GCTACTATTTCCCTGCAGGTAGG - Intergenic
979511185 4:121555816-121555838 GCTTTTAGTGACCCTGAGGTAGG + Intergenic
994252776 5:97556277-97556299 GCTTCTTGTGCCCTGCAGTTGGG + Intergenic
1001020724 5:168180215-168180237 GCATCTAGTGCCATGCACGTTGG - Intronic
1001723044 5:173872364-173872386 GTTTCTAGTGCCGAGCAGCTGGG - Intergenic
1004876001 6:19955412-19955434 GCTTCTAGTCCCAAGCATGTTGG - Intergenic
1008768407 6:54948548-54948570 GCTCCTAGTGCCCCCAAGATTGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1032090319 7:128908564-128908586 GATTCTTGTGCCCTTCAGGTGGG - Exonic
1036445390 8:8817647-8817669 GTTTCTAGTGCCAAACAGGTTGG - Intronic
1053817588 9:41928804-41928826 GCTTATAGTGCCACTGAGGTGGG + Intronic
1054107841 9:61072476-61072498 GCTTATAGTGCCACTGAGGTGGG + Intergenic
1054613016 9:67258649-67258671 GCTTATAGTGCCACTGAGGTGGG - Intergenic
1055725387 9:79222128-79222150 GCTTCTAGTACGCAGCAGGCAGG + Intergenic
1057299981 9:93872341-93872363 GCTCCTGGTGCCCTGCAGCTGGG + Intergenic
1061746446 9:132743714-132743736 ACTACCAGTGCCCGGCAGGTAGG - Intronic
1195917718 X:109952262-109952284 GCTGCTAGTGCCTGGCAGGCTGG - Intergenic