ID: 1182481893

View in Genome Browser
Species Human (GRCh38)
Location 22:30614550-30614572
Sequence GGAGGTCATCAGTGCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182481893_1182481902 10 Left 1182481893 22:30614550-30614572 CCAGGTCTGCACTGATGACCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1182481902 22:30614583-30614605 CCCCACACTCACCTTTCCTTGGG 0: 1
1: 0
2: 2
3: 31
4: 270
1182481893_1182481900 9 Left 1182481893 22:30614550-30614572 CCAGGTCTGCACTGATGACCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1182481900 22:30614582-30614604 CCCCCACACTCACCTTTCCTTGG 0: 1
1: 0
2: 5
3: 39
4: 345
1182481893_1182481904 11 Left 1182481893 22:30614550-30614572 CCAGGTCTGCACTGATGACCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1182481904 22:30614584-30614606 CCCACACTCACCTTTCCTTGGGG 0: 1
1: 0
2: 3
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182481893 Original CRISPR GGAGGTCATCAGTGCAGACC TGG (reversed) Intronic
900754226 1:4422633-4422655 GGACGTCATCACTGCAGTTCAGG - Intergenic
902331319 1:15732394-15732416 GGCGGTCATCCGTGAGGACCAGG - Exonic
903459130 1:23508633-23508655 AGAGGTCTTCATGGCAGACCAGG - Exonic
905354106 1:37369089-37369111 TGAGGCCATCAGTGCAGCCTGGG - Intergenic
905792239 1:40796174-40796196 GGGGGTAATCAGTGCACATCAGG + Intronic
906050526 1:42867723-42867745 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
906879704 1:49576761-49576783 TGAGGCCATCAGTGCAGACTGGG - Intronic
907306496 1:53516071-53516093 AGAGTCCATCAGTGCAGCCCCGG - Intronic
908737426 1:67291122-67291144 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
909172570 1:72315157-72315179 TGTGGCCATCAGTGCAGACTGGG + Intergenic
909810990 1:79931645-79931667 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
910630261 1:89346561-89346583 GGAGGCCATCAGTGCAGGCTGGG - Intergenic
912735352 1:112145276-112145298 GGAGGTCAGCAGTGGGCACCTGG + Intergenic
913011747 1:114690165-114690187 GGAGGTGTTAAGTGCAGAGCAGG - Intronic
913124469 1:115772389-115772411 GGAGGCCCTCAGTGTAGACCAGG + Intergenic
914965469 1:152253597-152253619 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
917764565 1:178202318-178202340 TGAGGCCATCAGTGCAGGCTGGG - Intronic
918015099 1:180625505-180625527 GGAGGTCAGCAGAGAAGCCCTGG - Intergenic
919124581 1:193379473-193379495 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
919977099 1:202619778-202619800 GGAGGGCATCAGAGCAGGGCAGG + Intronic
921619846 1:217313447-217313469 TGAAGTCATAAGTGCAGACTGGG - Intergenic
922617929 1:226974121-226974143 GGAGGTCATCAGAGCCAAACAGG - Intronic
1063464038 10:6231817-6231839 GGAGGTGATGAGTGCCCACCAGG - Intronic
1067545140 10:47187574-47187596 TGAGGTCAGCAGTTCAAACCAGG - Intergenic
1069030899 10:63595130-63595152 TGAAGTCATCAGTGCAGAAAAGG - Intronic
1071060470 10:81564552-81564574 GGAAGTCTTCTGTGAAGACCAGG - Intergenic
1071250491 10:83813906-83813928 GGAAGTTAACAGTGCAGTCCTGG - Intergenic
1072842737 10:98793506-98793528 GGAAGTCATCAGAACAGACAAGG + Intronic
1074846700 10:117405038-117405060 TGATTTCATCATTGCAGACCAGG + Intergenic
1076536658 10:131182323-131182345 GGAGGTCCTCAGGGCAGGGCCGG + Intronic
1078462621 11:11526174-11526196 GGATGTCATCAGGGAAGACCAGG + Intronic
1079009295 11:16815156-16815178 GGAGCCCACCAGTGCTGACCTGG + Intronic
1080429605 11:32186030-32186052 GGAGGCCATCTGAGCAGATCAGG - Intergenic
1081110509 11:39128694-39128716 CGAGGCCATCAGTGCAGGCTGGG - Intergenic
1081378326 11:42386226-42386248 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1083318704 11:61832160-61832182 AGAGGTCACCAATGCAGACCGGG - Intronic
1087742141 11:101900246-101900268 GTAGGTCTTCAGTGGAGATCTGG - Intronic
1088407573 11:109498379-109498401 TGAGGTCATCGGTGCAGGCTGGG + Intergenic
1090443164 11:126741011-126741033 GGAGCTCATTCCTGCAGACCCGG + Intronic
1090745027 11:129698482-129698504 GGAGGTCAGAACTGCAGACCTGG + Intergenic
1093484759 12:19640903-19640925 GGAGGACATCATTGCACACATGG - Intronic
1095856209 12:46863392-46863414 TGAGGTCATTAGTGCAGGCTGGG + Intergenic
1096370430 12:51064567-51064589 GGAGGTAATGAGTCCGGACCCGG + Exonic
1097077035 12:56402725-56402747 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1097437800 12:59571970-59571992 TGAGGCCATCAGTGCAGGCTAGG + Intergenic
1097821315 12:64131621-64131643 TGAGGCCATCAGTGCAGCCTGGG + Intronic
1099056137 12:77843346-77843368 TGGGGTCCACAGTGCAGACCTGG - Intronic
1099735816 12:86565320-86565342 TGAGGCCATCAGTGCAGGCTGGG - Intronic
1102152305 12:110697221-110697243 GGGCGTCATCAGTGCACAACTGG + Intronic
1103396564 12:120611731-120611753 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1104135165 12:125930959-125930981 GGATGTCAGCAGTGCAGCCCTGG - Intergenic
1104634436 12:130428710-130428732 GGTGGGGATCAGTGCACACCAGG + Intronic
1104921734 12:132294176-132294198 GGAGGTCAATGGTGAAGACCTGG - Intronic
1105831351 13:24165292-24165314 GTGGGTCTTCAGGGCAGACCTGG - Intronic
1114487129 14:23069511-23069533 GGCGGTCATCATTGCTGACTTGG + Exonic
1116068131 14:40009452-40009474 TGAGGCCATCAGTGCAGGCTTGG - Intergenic
1117817410 14:59612024-59612046 GGAGGTCATCTGTCCCCACCTGG + Intronic
1121413918 14:93765783-93765805 GGAGGTCTTCAGTGTTGACTTGG - Intronic
1122375545 14:101254611-101254633 AGAGGTGATCAGTTCAAACCAGG - Intergenic
1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG + Intronic
1124361500 15:29039797-29039819 GGATGACATCAGTGCTGTCCAGG + Intronic
1127635864 15:60869165-60869187 GCAGGTCCTCAGTGCAGCCAAGG + Intronic
1127893569 15:63276059-63276081 GGAGGTCCTCAGTGCAACGCAGG - Intronic
1128085563 15:64884071-64884093 GCAGGTCCTCAGAGCAGACAGGG - Intronic
1128880094 15:71234911-71234933 GGGGATCCTCAGTGCAGCCCTGG - Intronic
1130138346 15:81200418-81200440 GGAGTTCAGCAGTGCAATCCCGG + Intronic
1130395808 15:83500433-83500455 GGAGTTCATCAATGAAGCCCTGG + Intronic
1131106703 15:89739649-89739671 TGGGGTCATCAGTGGAGTCCTGG + Intronic
1131166185 15:90143689-90143711 GGAGGTCAACACTGCAGGACTGG - Intergenic
1131578252 15:93613961-93613983 GCAGGTCATTGGTGGAGACCAGG + Intergenic
1132305697 15:100810584-100810606 TGAGGTCATAGGTGCAGACTGGG + Intergenic
1133201200 16:4205698-4205720 TGAGGTCCTCAGGGCTGACCGGG + Intronic
1135313185 16:21421570-21421592 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1135366109 16:21853848-21853870 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1135445706 16:22517316-22517338 GGAGGTTATTCGTGCAGCCCAGG - Intronic
1135464279 16:22671926-22671948 GGAGGCCATCACTGCAGAGAAGG + Intergenic
1135758141 16:25115032-25115054 AGAGGTGATCACTGCAGACCAGG - Intronic
1136152339 16:28359299-28359321 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1136194406 16:28641892-28641914 GGAGGTTATTCGTGCAGCCCAGG - Intronic
1136210742 16:28755982-28756004 GGAGGTTATTCGTGCAGCCCAGG - Intronic
1136250980 16:29004875-29004897 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1136309853 16:29400285-29400307 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1136323297 16:29502075-29502097 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1136437982 16:30242044-30242066 GGAGGTTATTCGTGCAGCCCAGG + Intronic
1136499364 16:30662416-30662438 CGAGGTCATCATCGGAGACCTGG - Exonic
1136518930 16:30784180-30784202 GGAGATCATCATGGGAGACCCGG - Exonic
1137002408 16:35240849-35240871 AGAGGTCATCACTGCATGCCAGG + Intergenic
1138281282 16:55773737-55773759 GCAGGTGATCAGGGCAGAGCTGG + Intergenic
1138287257 16:55820124-55820146 GCAGGTGATCAGGGCAGAGCTGG - Intronic
1139673348 16:68506606-68506628 GGAGGACCTCAATGCAGACAGGG + Intergenic
1139680949 16:68562422-68562444 GGAGGTAATTAGTGTAGAACCGG + Intronic
1139857538 16:69992673-69992695 GGAGGTTATTCGTGCAGCCCAGG + Intergenic
1140459846 16:75130937-75130959 GGAGGTCAGCAGGGCACAGCAGG - Intergenic
1140729541 16:77843668-77843690 GGCTGTATTCAGTGCAGACCTGG + Intronic
1142601141 17:1053496-1053518 GGAGGTGATCTGTGCAGAGCTGG - Intronic
1146850970 17:36221322-36221344 TGAGGCCATCAGTGCAGGCTGGG - Intronic
1150365145 17:64576152-64576174 GGAGAGCAGCAGTGCAGTCCTGG - Intronic
1150709620 17:67519536-67519558 TGAGGTCGTCAGTGAAGACAGGG - Intronic
1153089747 18:1330441-1330463 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1154070227 18:11146945-11146967 TATGGTCCTCAGTGCAGACCGGG - Intronic
1154118983 18:11635928-11635950 GGAGGTTATTCGTGCAGCCCAGG + Intergenic
1155176785 18:23307940-23307962 GGTGTTCAGCAGGGCAGACCGGG - Intronic
1155940796 18:31800197-31800219 TGAGGCCATCAGTTCAGACTGGG - Intergenic
1161063216 19:2225661-2225683 GGAGGCCCTCACTGCAGCCCAGG + Intronic
1161699713 19:5787935-5787957 GGAGGCAACCAGGGCAGACCTGG + Intronic
1163728200 19:18934320-18934342 GGAGCTCACCAGTCCAGCCCTGG - Exonic
1164097054 19:22021072-22021094 TTAGGTCATCAGTGCAGGCTGGG + Intergenic
1164117225 19:22234294-22234316 TTAGGTCATCAGTGCAGGCTGGG + Intergenic
1165076005 19:33280257-33280279 CCAGGTCATCTCTGCAGACCAGG + Intergenic
1165408547 19:35644556-35644578 GGCGGTGTGCAGTGCAGACCTGG - Intronic
1165767435 19:38360083-38360105 GGTGGGCATCAGTGCAGAGATGG + Intronic
1167891450 19:52543004-52543026 AGGGGGCATCAGTGCAGCCCAGG + Intronic
1168207293 19:54860461-54860483 GGAGGAGATCAGTTCAGCCCAGG - Intronic
925006987 2:451426-451448 GGAGGTCAGGACTGCAGAACGGG + Intergenic
926058719 2:9792081-9792103 GGAGGTGGTCAGTGCTGCCCAGG + Intergenic
926198979 2:10780038-10780060 GGAGCTCCTCAGTGCAGGCGGGG - Intronic
927093067 2:19727210-19727232 GGAGGTCAGCAGTGCAAAATGGG - Intergenic
927140941 2:20130362-20130384 GGAGGTCAGGAGTCCAGACATGG + Intergenic
927844782 2:26465754-26465776 TGAGGTCATCAGTGCCCACCAGG + Exonic
928203752 2:29269348-29269370 GGTGGACATCAGTGAACACCAGG - Intronic
930395825 2:50823307-50823329 CTAGGCCATCAGTGCAGACCTGG + Intronic
931275340 2:60739343-60739365 GGAGGGCAGCAGTGCAAACATGG + Intergenic
933265647 2:80178095-80178117 TGAGGCCATCAGTGCAGGCTGGG + Intronic
934166662 2:89300133-89300155 GAAAGTCCTCAGTGCAGACAGGG - Intergenic
934200619 2:89882324-89882346 GAAAGTCCTCAGTGCAGACAGGG + Intergenic
935564274 2:104589971-104589993 TGAGGACATCAGTGCAGGCTGGG + Intergenic
935920121 2:108003693-108003715 GGGGGTTATCAGAGTAGACCAGG - Intronic
939069109 2:137518179-137518201 TGAGGCCATCAGTGCAGGCTGGG - Intronic
939365149 2:141220891-141220913 GGAGGTCTTCAAGGCAGGCCTGG - Intronic
939788649 2:146545831-146545853 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
940605883 2:155924006-155924028 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
940804702 2:158173769-158173791 GGAGCACATGAGAGCAGACCAGG - Intronic
943384030 2:187180811-187180833 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
943447493 2:188005959-188005981 GGAGGGCAGCAGTGCAGTCTTGG - Intergenic
946527832 2:220539690-220539712 TGAGGGCATCAGTGCAGGCTGGG + Intergenic
946757239 2:222959948-222959970 GGACGTCATCAGGGAACACCTGG - Intergenic
946995812 2:225389760-225389782 GGAAGTCATGAGTGCAAAACTGG + Intergenic
947440880 2:230120536-230120558 TGAGGTCATCAGTGCAGGCTAGG - Intergenic
947815228 2:233032305-233032327 GGAGGACAGCAGTGCAGGCCGGG - Intergenic
948120887 2:235529657-235529679 GGAGGTCATCAGTGGGGGTCAGG - Intronic
948876648 2:240833065-240833087 GGAGGGGATCTGTGAAGACCAGG - Intergenic
1169374064 20:5052128-5052150 GGAGGTCAAGACTGCAGGCCGGG + Intergenic
1169965689 20:11214820-11214842 GGAGGCCATCAAAGCATACCAGG - Intergenic
1175869471 20:62201450-62201472 CCAGGTCAGAAGTGCAGACCAGG + Exonic
1176345312 21:5738673-5738695 AGAGGTCATCACTGCATGCCAGG - Intergenic
1176352126 21:5859257-5859279 AGAGGTCATCACTGCATGCCAGG - Intergenic
1176499515 21:7585782-7585804 AGAGGTCATCACTGCATGCCAGG + Intergenic
1176539633 21:8136743-8136765 AGAGGTCATCACTGCATGCCAGG - Intergenic
1176558584 21:8319788-8319810 AGAGGTCATCACTGCATGCCAGG - Intergenic
1176998198 21:15580466-15580488 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1177913216 21:27056492-27056514 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1181758069 22:25039455-25039477 GGAGGTCACCCCTGCTGACCTGG + Exonic
1182481893 22:30614550-30614572 GGAGGTCATCAGTGCAGACCTGG - Intronic
1185178176 22:49342820-49342842 GGAGGACGTCACTGCAGACATGG + Intergenic
1185276768 22:49953308-49953330 GGAGGGCATCCGGGCAGTCCCGG - Intergenic
1203244584 22_KI270733v1_random:53098-53120 AGAGGTCATCACTGCATGCCAGG - Intergenic
949245904 3:1925204-1925226 AGAGGCCATCAGTGCAGGCTTGG - Intergenic
951230923 3:20178983-20179005 AGAGGTCATCATTGCATATCTGG + Intronic
951287749 3:20835999-20836021 GGAGGTCATCCATGGAGTCCAGG - Intergenic
951361837 3:21734691-21734713 CTAGGTGATCAGTGCAGCCCAGG - Intronic
954054194 3:48008246-48008268 TGAGGCCATCAGTGCAGGCTGGG - Intronic
954154924 3:48680154-48680176 GGAGGTGATCTTTGCAGACCTGG - Exonic
954511452 3:51129383-51129405 TGAGGCCATCAGTGCAGGCTAGG + Intronic
954793602 3:53150023-53150045 GCAGGTACTCAGTGAAGACCAGG - Intergenic
959997896 3:112698601-112698623 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
960494711 3:118360499-118360521 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
961262886 3:125616704-125616726 TGAGGCCATCAGTGCAGACTGGG - Intergenic
962958773 3:140290896-140290918 GGAGGGCATCATTGCAGATCAGG - Intronic
963823957 3:149931275-149931297 TGAGGCCAGCAGTTCAGACCTGG - Intronic
963831570 3:150014696-150014718 GGAGGTCATCAGAGAACACCAGG + Intronic
964679205 3:159318633-159318655 TGAGGCCATCAGTGCAGGCTGGG + Intronic
967264015 3:187674217-187674239 TGAGGTCAGCAAGGCAGACCAGG + Intergenic
967831818 3:193926271-193926293 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
968943728 4:3652884-3652906 GCAGGTCATGGGGGCAGACCTGG + Intergenic
968970732 4:3792185-3792207 GCAGGTCATCAGCGCAGGCAAGG + Intergenic
969657024 4:8504385-8504407 GGAGGGCAGCAGCGCAGGCCCGG - Intergenic
973202787 4:47523084-47523106 CGAGGTCATCCCTGCAGACATGG + Exonic
974289605 4:59913022-59913044 TGAGGTCATCAGTGCAGGCTTGG - Intergenic
974727251 4:65812803-65812825 TGAGGCCATCAGTGCAGGCTTGG - Intergenic
978341552 4:107725268-107725290 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
979767051 4:124474876-124474898 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
980387912 4:132110900-132110922 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
980629563 4:135414572-135414594 TGAGGTCATCAGTGCAGGCCGGG - Intergenic
981447558 4:144857701-144857723 TGAGGTGTTCAGTGGAGACCTGG + Intergenic
982027699 4:151267874-151267896 GGAGGAGATGAGTGCAGTCCAGG + Intronic
982404026 4:155000624-155000646 GGAGGTTGCCAGTGCAGACAAGG + Intergenic
983185099 4:164691855-164691877 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
984096541 4:175442091-175442113 TGAGGTCCTCAGTACAGAGCAGG - Intergenic
985832371 5:2243600-2243622 TGAGGCCATCAGCGCAGACTAGG - Intergenic
987578309 5:19758029-19758051 TGAGGCCTTCAGTGCAGACTGGG + Intronic
988079792 5:26401146-26401168 AGAGGCCATCAGTGCAGGCTGGG + Intergenic
988188813 5:27901516-27901538 AGAGGCCATCAGTGCAGGCTGGG - Intergenic
988298143 5:29391672-29391694 GGAGGTCATCAGTGTGTGCCTGG - Intergenic
988562165 5:32291121-32291143 TGAGGTCATCGGTGCAGGCTGGG - Intronic
988936323 5:36086723-36086745 AGAGGTCAGCAGAGCAGAGCAGG - Intergenic
989486346 5:41996077-41996099 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
993791820 5:92219190-92219212 TGAGGCTATCAGTGCAGACTAGG - Intergenic
994291334 5:98031670-98031692 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
994886093 5:105563961-105563983 GCTGGTCATAAGTGCACACCAGG + Intergenic
995088369 5:108141795-108141817 GGAGGAGAGCAGTGCAGGCCTGG - Intronic
995427696 5:112043445-112043467 GGAGACCATCAGTGCAGGCTTGG + Intergenic
997758080 5:136419336-136419358 GGAGGTAGACAGTGCAGGCCTGG + Intergenic
1003791263 6:9550327-9550349 TGAGGCCATCAGTGCAGGCTTGG - Intergenic
1005813767 6:29534194-29534216 GGGGCTCATCTGTGCAGCCCAGG + Intergenic
1006314520 6:33282342-33282364 AAAGGCCATCAGTGCAAACCAGG + Intronic
1008340305 6:50356648-50356670 GGAGGCCATCAGTGCAGGTTGGG - Intergenic
1008893837 6:56528569-56528591 GGAGCTCATCAGAGAAGCCCAGG - Intronic
1009390080 6:63134795-63134817 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1009660657 6:66606640-66606662 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1009851888 6:69208675-69208697 TGAGGCCATCAGTGCAGGCGAGG + Intronic
1009993810 6:70877253-70877275 GAAGGTCACCAGTGCAGGCCTGG + Intronic
1010938209 6:81886129-81886151 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1010980791 6:82365966-82365988 GGAACTCAACAGTGCTGACCTGG + Exonic
1012344619 6:98170602-98170624 GGAGGCTATCAGTGCAGGCTGGG - Intergenic
1013232743 6:108171613-108171635 GGAGCCCAGCAGTGCAGCCCTGG - Intronic
1015095413 6:129409318-129409340 TGAGGCCATCAGTGCAGGCTTGG + Intronic
1016391318 6:143578675-143578697 GGAGGACATGAGTGCAGAAGAGG + Intronic
1017227771 6:152040809-152040831 TGAGGCCATCAGTGCAGGCTGGG + Intronic
1017388420 6:153911940-153911962 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1019352742 7:562554-562576 GCAGGTGATGAGTGCAGGCCTGG - Intronic
1019761302 7:2814839-2814861 GGAGGGGAGCAGTGCACACCCGG - Intronic
1021244697 7:18246818-18246840 GGAGGTTATCAGTGTAATCCAGG + Intronic
1021656070 7:22875166-22875188 GGTGGTCACCAGTGCACAGCAGG + Intergenic
1022248970 7:28587981-28588003 GGAGCTCTTCACTGCAGATCAGG + Intronic
1022684078 7:32578308-32578330 GGAGGGCCTCAGAGCAAACCAGG + Intronic
1026125973 7:67579824-67579846 GGAGGTCATGACTACAGACCTGG + Intergenic
1028141771 7:87282264-87282286 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1029443252 7:100599872-100599894 AGGGGTCAGCAGGGCAGACCTGG + Intronic
1029600264 7:101559154-101559176 GGAGGTCCTGAGGGCAGAGCTGG - Intergenic
1030355525 7:108538347-108538369 TGAGGCCATCAGTGCAGGCTGGG - Intronic
1030457423 7:109792770-109792792 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1032109386 7:129062503-129062525 GTAAGTCAAAAGTGCAGACCGGG - Intergenic
1032153068 7:129446676-129446698 TGAGGCCATCAGTGCAGGCTGGG + Intronic
1032903509 7:136337985-136338007 GATGGTCATCAGCCCAGACCTGG + Intergenic
1033183652 7:139205106-139205128 TGAGGTAATAAGTGCAGTCCTGG - Intergenic
1034357223 7:150460696-150460718 TGAGGTCATGAGTGCAGATTGGG + Intronic
1034935786 7:155199798-155199820 AGGGGTCATCAGCACAGACCCGG - Intergenic
1034986531 7:155519094-155519116 GCAGGTCATCAGCGAACACCTGG + Intronic
1037953653 8:23036393-23036415 TGAGGCCATAAGTGCAGGCCAGG - Intronic
1038329411 8:26596347-26596369 GCAGGACAGCAGTGCAAACCAGG + Intronic
1040072001 8:43196057-43196079 GGAGGCTAGGAGTGCAGACCTGG + Intronic
1040414951 8:47187723-47187745 GGAGGCCACCAGGCCAGACCTGG + Intergenic
1041934588 8:63321611-63321633 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1042046600 8:64659879-64659901 GGTGGTTATCAGTGCAGAGGTGG + Intronic
1044285937 8:90412166-90412188 TGAGGCCATCAGTGCAGGCTAGG + Intergenic
1045221875 8:100207346-100207368 GGAGGCCATCGGTGCAGGCTGGG - Intronic
1045246273 8:100444195-100444217 GGAGATCATCAGTGCAGCAGGGG + Intergenic
1047317459 8:123747761-123747783 AGAGGCCTTCACTGCAGACCAGG + Intergenic
1048304596 8:133274922-133274944 GGAGGCCCTCAGTGCTGGCCTGG + Intronic
1049603457 8:143518632-143518654 GGAGGCCCTCAGGGCACACCTGG - Intronic
1050308996 9:4333947-4333969 AGAGGTCATCAGAGCAGACAAGG - Intronic
1052368690 9:27641117-27641139 TGAGGCCATCAGTGCAGGCTAGG - Intergenic
1052442231 9:28512001-28512023 TGAGGTCATCAGTGCAGGCTGGG + Intronic
1052956232 9:34255140-34255162 GGTGGTCATCCGAGCACACCAGG - Exonic
1056690412 9:88803488-88803510 AGAGGTCATTAGTGCTCACCTGG + Intergenic
1057730402 9:97603294-97603316 GGAGGTCATCAGGGAAAAACAGG - Intronic
1061448657 9:130656553-130656575 GGAGTTCATCTCTGCACACCTGG + Intergenic
1062076932 9:134594673-134594695 GGAGGGGAGCAGTGCAGGCCGGG - Intergenic
1062536351 9:137022735-137022757 GGAGGCCCTCAGTGCGGGCCCGG - Exonic
1203460916 Un_GL000220v1:36181-36203 AGAGGTCATCACTGCATGCCAGG - Intergenic
1185638146 X:1570156-1570178 GGAGTGCATCAGTGCAAACTTGG - Intergenic
1192898734 X:75472184-75472206 TGAGGCCATCAGTGCAGGCTGGG - Intronic
1194521118 X:94919717-94919739 TGAGGTCATTAGTGCAGGACTGG - Intergenic
1195202815 X:102566130-102566152 GGCAGTCAGCAGTGCATACCAGG - Intergenic
1197477322 X:126941050-126941072 TGAGGCCATCAGTGCAGGCTGGG + Intergenic
1200651705 Y:5848028-5848050 TGAGGCCATCAGTGCAGGCTGGG - Intergenic
1201529621 Y:14977611-14977633 TGAGGCCATCAGTGCAGGCAGGG + Intergenic