ID: 1182483653

View in Genome Browser
Species Human (GRCh38)
Location 22:30626437-30626459
Sequence CTGCAGAAACAGATTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182483653_1182483656 5 Left 1182483653 22:30626437-30626459 CCTTGCTCAATCTGTTTCTGCAG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1182483656 22:30626465-30626487 GCTGACTACAGACCCAAGGATGG 0: 1
1: 0
2: 0
3: 18
4: 167
1182483653_1182483660 28 Left 1182483653 22:30626437-30626459 CCTTGCTCAATCTGTTTCTGCAG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1182483660 22:30626488-30626510 AGAAACCATTGAGCTGAGGCTGG 0: 1
1: 0
2: 0
3: 28
4: 251
1182483653_1182483655 1 Left 1182483653 22:30626437-30626459 CCTTGCTCAATCTGTTTCTGCAG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1182483655 22:30626461-30626483 TATTGCTGACTACAGACCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 140
1182483653_1182483659 24 Left 1182483653 22:30626437-30626459 CCTTGCTCAATCTGTTTCTGCAG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1182483659 22:30626484-30626506 ATGGAGAAACCATTGAGCTGAGG 0: 1
1: 1
2: 1
3: 27
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182483653 Original CRISPR CTGCAGAAACAGATTGAGCA AGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901013823 1:6216313-6216335 CTGCAGAAATAAATTGAGGCTGG + Intronic
902192055 1:14770635-14770657 CTGGAGAAACAAATTTAGCCTGG + Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
906566765 1:46806468-46806490 CTGCAGAAAGAGACTAAGCCAGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
910806522 1:91194001-91194023 CTGCAGTGGCAGATTGAGCTGGG - Intergenic
910903479 1:92148258-92148280 CGGCAGAAACATTATGAGCAAGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914873962 1:151498657-151498679 CTCCAGACAACGATTGAGCATGG - Intergenic
915653131 1:157334276-157334298 CTGCAGCAAAGGAGTGAGCAGGG - Intergenic
918598887 1:186328786-186328808 TTGTGGAAATAGATTGAGCAAGG - Intronic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
920896878 1:210060038-210060060 ATGCTGAAACAGATGTAGCAAGG - Intronic
922057740 1:222057479-222057501 CTCCAGAAAAAGATGTAGCATGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923047205 1:230364102-230364124 GTGAACAAAGAGATTGAGCAAGG - Intronic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
924244368 1:242068196-242068218 CTGAATAAACCTATTGAGCAAGG - Intergenic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1067842533 10:49692334-49692356 CTTCAGAAAGAGACTCAGCAAGG - Intronic
1068075213 10:52245212-52245234 CTACAGAAACAGTTTGAAAAAGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1075447763 10:122525664-122525686 CTACAGAAAGAGATTGACTATGG - Intergenic
1075977057 10:126705223-126705245 CTGCAGGAATAAAGTGAGCAAGG - Intergenic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1078545510 11:12244183-12244205 CTGCACAAACATCTTGAGCCTGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1081311606 11:41581185-41581207 CTGCAGAAACAAAATTAGCTGGG - Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1081807972 11:45900415-45900437 CTGCGGAAAGAGGTTGAGCGTGG - Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092580179 12:9832982-9833004 CTGCAGAAAAACATTAAGAAAGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1096090329 12:48895358-48895380 CTGCAGAAACACATTCAGATAGG + Intergenic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1104753168 12:131252712-131252734 CTGCTGAAGGAGATAGAGCATGG - Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107161170 13:37229882-37229904 CTTCAGGAACAGTTTGATCAAGG + Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1117053021 14:51881139-51881161 CTGCTGAAAAAGATTCAGCGAGG - Intronic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1119670302 14:76513415-76513437 CTGCAAAAGCAGATTGGACAGGG + Intergenic
1119970905 14:78969198-78969220 CTACAGGAACAGGCTGAGCATGG - Intronic
1120678056 14:87445335-87445357 TTGCAGAAATAGAGTTAGCAGGG - Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1122275794 14:100590162-100590184 CCACAAGAACAGATTGAGCAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1130763807 15:86849848-86849870 CTTTAGAAACAGAGTGAGTAAGG + Intronic
1132486512 16:195071-195093 CTTCAGACACAGGATGAGCATGG - Intronic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1139333316 16:66211164-66211186 TTGCTGAAACTGATTCAGCAGGG - Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1144045873 17:11454181-11454203 GTGCAGAAATAGATTGAATATGG - Intronic
1144049817 17:11488964-11488986 CTTCAGAAACAGACTCATCAGGG - Intronic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1144617038 17:16786156-16786178 CTGCAGTAACAGAAATAGCATGG + Intronic
1144895655 17:18529518-18529540 CTGCAGTAACAGAAATAGCATGG - Intergenic
1145136563 17:20414713-20414735 CTGCAGTAACAGAAATAGCATGG + Intergenic
1146907749 17:36628972-36628994 CCCATGAAACAGATTGAGCAAGG + Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1148180592 17:45602062-45602084 CTGCGGAAAGAGGTTGAGCGTGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148268310 17:46243853-46243875 CTGCGGAAAGAGGTTGAGCGTGG - Intergenic
1151277109 17:73043448-73043470 CTACAGAAACAGATTTGCCAGGG + Intronic
1151546754 17:74797949-74797971 CTTCTGAAACAGAATGACCAGGG - Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152198867 17:78933764-78933786 CTGCAAGGACAGTTTGAGCAGGG + Intergenic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155175432 18:23297702-23297724 CTGCAGAACCAGCTACAGCACGG + Exonic
1155717347 18:28961464-28961486 CTTCAAAAACATGTTGAGCAAGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157523664 18:48362572-48362594 CAGCAGAAACTGATTGTTCATGG - Intronic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1158845763 18:61441109-61441131 CTTCAAAAACTGATTGATCATGG + Intronic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1161408214 19:4102242-4102264 CTGCAGAAAGAGAGTGGCCAAGG - Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1165683852 19:37800820-37800842 CTGCTGAAACAGATTGCACGAGG - Intronic
1166950994 19:46428012-46428034 CTGCAGAAAGAGGTTCAGCTTGG + Intergenic
1167034669 19:46988045-46988067 CTGCAGAGACAGTTTGATCAAGG + Exonic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1168078889 19:53994833-53994855 CTGCAGAAATAAAATGATCAAGG - Intronic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
927261698 2:21098145-21098167 CTAAAGAAACAGATTGCTCAGGG - Intergenic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929714985 2:44301116-44301138 CGGCAGATACAGGTTGACCACGG + Exonic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
932254849 2:70275701-70275723 CTGCAGAAAATGATTGCTCAGGG + Intronic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933391349 2:81672210-81672232 ATGCATAAACATATTGAGTAAGG - Intergenic
937742495 2:125373046-125373068 CTTCAGAAATACAATGAGCAGGG - Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943337778 2:186639658-186639680 ATGCAATAACAGATTGAGCATGG - Intronic
945274308 2:207972785-207972807 CTGCAGAAAAAAATGGACCATGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
947817120 2:233045076-233045098 CTCCAGAGACAGGCTGAGCAGGG - Intergenic
948077419 2:235176079-235176101 GTGCTGAAACAAATTAAGCAGGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169164278 20:3408295-3408317 CTGCAGAAACCGGTAGAGCTAGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171973715 20:31580519-31580541 CTGTAGAAACAGACTGTGCGGGG - Intergenic
1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG + Intronic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173725850 20:45297185-45297207 CTCCAGAAACAGACTAAGTAGGG - Intronic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182256355 22:29041626-29041648 CCACAGAGACTGATTGAGCAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951094926 3:18617636-18617658 ATACAGAAACAAATTAAGCATGG - Intergenic
952482708 3:33778021-33778043 CTCCAGAAAAAGAATGAGCGGGG - Intergenic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
952690892 3:36204340-36204362 CTGCAGAATTGGACTGAGCATGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
961003767 3:123391101-123391123 CTGCCCAAACAGACTGACCAGGG + Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
967189642 3:186974302-186974324 CTGCAGGAACCGACTGAGCTTGG + Intronic
967541005 3:190667786-190667808 CAGCAGTAACAGCTTGACCATGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
971089950 4:23330408-23330430 CTTCAGATACAGATTCATCAAGG - Intergenic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
976633955 4:87268658-87268680 CTTCAGATTCAGATTGAGAAGGG + Intergenic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
978611380 4:110544973-110544995 CTGCAGAACCTCATTGAGCCAGG - Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
988078234 5:26381460-26381482 CTGCAGAAACAACTTGCCCAAGG + Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
991651447 5:68859062-68859084 CTGCAGTAACAGATTGATTGTGG - Intergenic
992553651 5:77882991-77883013 CTGCAGAGGCAGATTCTGCAAGG - Intergenic
995076284 5:107988298-107988320 CTGCAGAAACAGATTAATCTGGG + Intronic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995452832 5:112321319-112321341 CTGCAGTAACACAATGACCAAGG + Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996154397 5:120080071-120080093 AGGCAGAGAGAGATTGAGCATGG + Intergenic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
1001406874 5:171482709-171482731 GTTCAGAAACAGATTGACCAAGG - Intergenic
1002129912 5:177074468-177074490 CTCCAGAAACAGCTTGATCCTGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1005810400 6:29510969-29510991 CTGCACACTCAGATTGTGCAGGG - Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008902121 6:56632843-56632865 CTGCAGAAAGAGGTAAAGCATGG - Exonic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1011347392 6:86386780-86386802 CTACAGAAATAAATTAAGCATGG - Intergenic
1012744604 6:103069506-103069528 CTCCAGAAACAGATTTTCCAGGG + Intergenic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1016480628 6:144477014-144477036 GTGCAGAAAGAGATTGAGATAGG + Intronic
1016582816 6:145648322-145648344 CTGCAGAACTAGACTGACCAAGG - Intronic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020044486 7:5031061-5031083 CAGTAGAAACAGATCTAGCATGG - Intronic
1020719217 7:11720446-11720468 CAGTAGAAAGAGATTAAGCATGG - Intronic
1021268886 7:18560207-18560229 CAGCAGAGAGATATTGAGCATGG + Intronic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1022387836 7:29918144-29918166 CTTCAGAGTCACATTGAGCATGG + Intergenic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1023224099 7:37951038-37951060 CTAAAGAAACATTTTGAGCAAGG + Exonic
1023930955 7:44706285-44706307 CAGCAGAAACAGAGTAAACATGG + Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1038753327 8:30316875-30316897 CTGCAGCAACAGATTAGGCTTGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1049423416 8:142526710-142526732 CTGCAGTCTCAGATTGGGCATGG - Intronic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1056454435 9:86746325-86746347 CTCCAGGAACAGAGTGAGCGAGG + Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1059135227 9:111799682-111799704 CAGCTGAAACAATTTGAGCAGGG - Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062095239 9:134699742-134699764 CTGCAGGAGCAGTTTGATCAAGG + Intronic
1185967945 X:4628738-4628760 CAGCAGACACTGATTGATCATGG - Intergenic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1191749429 X:64525760-64525782 CTACAGAAACAAACAGAGCATGG + Intergenic
1191922149 X:66268382-66268404 CTCCAGAAACCCATTGACCATGG - Exonic
1195821681 X:108951932-108951954 ATACAAAAACAGCTTGAGCAAGG - Intergenic