ID: 1182483736

View in Genome Browser
Species Human (GRCh38)
Location 22:30626815-30626837
Sequence TCAGACTCCTTGGCAAAAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182483732_1182483736 5 Left 1182483732 22:30626787-30626809 CCCCATGGTCTGATGGGCATGAA 0: 1
1: 0
2: 0
3: 17
4: 106
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483725_1182483736 29 Left 1182483725 22:30626763-30626785 CCTGCAGGTCTCCCATGAAGGCC 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483733_1182483736 4 Left 1182483733 22:30626788-30626810 CCCATGGTCTGATGGGCATGAAG 0: 1
1: 0
2: 1
3: 4
4: 112
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483731_1182483736 8 Left 1182483731 22:30626784-30626806 CCACCCCATGGTCTGATGGGCAT 0: 1
1: 0
2: 1
3: 2
4: 100
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483734_1182483736 3 Left 1182483734 22:30626789-30626811 CCATGGTCTGATGGGCATGAAGC 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483724_1182483736 30 Left 1182483724 22:30626762-30626784 CCCTGCAGGTCTCCCATGAAGGC 0: 1
1: 0
2: 0
3: 18
4: 225
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483727_1182483736 18 Left 1182483727 22:30626774-30626796 CCCATGAAGGCCACCCCATGGTC 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309
1182483728_1182483736 17 Left 1182483728 22:30626775-30626797 CCATGAAGGCCACCCCATGGTCT 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG 0: 1
1: 0
2: 1
3: 25
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182483736 Original CRISPR TCAGACTCCTTGGCAAAAAA CGG Exonic
900645865 1:3708512-3708534 TCAGCCTCCTTGGCTGTAAAAGG - Intronic
904906928 1:33904480-33904502 TCAGATTCATAGGCAGAAAATGG - Intronic
908792777 1:67799251-67799273 TCAGACTATTTGGTAAAAATGGG - Intronic
909310692 1:74144233-74144255 TAAGACTCCTTGTCAAATGAAGG - Intronic
910479678 1:87644923-87644945 TCAAACTCCTTTGAAAACAATGG + Intergenic
910665078 1:89716239-89716261 TCAAAATCCTTGACATAAAATGG - Exonic
911908923 1:103606512-103606534 TGAGACTCCATCTCAAAAAAAGG + Intergenic
911913996 1:103672949-103672971 TGAGACTCCATCTCAAAAAAAGG - Intronic
913428880 1:118766811-118766833 CGAGCCTCCTTGGCAGAAAAAGG - Intergenic
914454360 1:147822012-147822034 CCAGGCTACTTGGCAAAGAAAGG - Intergenic
915252715 1:154602094-154602116 TTATACTCCCTGGCAAAGAAGGG - Exonic
917185053 1:172344268-172344290 TCACAATTCTTGGCAAAATATGG - Intronic
917337646 1:173941918-173941940 TGAGACTCCCTCTCAAAAAAAGG + Intronic
917941492 1:179927093-179927115 TCAGTTTCCTTGTCTAAAAATGG + Intergenic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
919094628 1:193016102-193016124 TCAGACTCAATGTCAAATAATGG + Exonic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920736461 1:208537384-208537406 TCAGGCTGCTTGGCAACAATGGG + Intergenic
921139034 1:212287431-212287453 TTAGACTCCTTGCCAAACTAAGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921881013 1:220253959-220253981 TCAGCCTCCTTGGAAGAAAAGGG + Intronic
923968754 1:239175864-239175886 TCAAACTATTTGTCAAAAAAGGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924662467 1:246034255-246034277 TCAGATTCATAGGGAAAAAAAGG - Intronic
1063218082 10:3942074-3942096 TGAGACTCTGTGGAAAAAAAAGG + Intergenic
1063467119 10:6254028-6254050 TGAGACTCCGTCTCAAAAAAAGG + Intergenic
1063512909 10:6663599-6663621 TCAGAAACCTTGGGAAAAGAGGG + Intergenic
1064243768 10:13653481-13653503 TGAGACTCCGTCTCAAAAAAAGG + Intronic
1064299696 10:14112535-14112557 TGAGACTCCATCTCAAAAAAAGG - Intronic
1064384856 10:14880470-14880492 TCAGATTCACTGGAAAAAAATGG - Intronic
1067220477 10:44340560-44340582 TGAGACTCACTGGTAAAAAATGG + Intergenic
1068709341 10:60116254-60116276 ACAGAGTTCTAGGCAAAAAATGG + Intronic
1069554529 10:69389182-69389204 TCAAATTCCTTTGCAAAGAAAGG - Exonic
1069592940 10:69653003-69653025 ACAGGCTCCTGGGCAAAAGAGGG + Intergenic
1069776558 10:70930583-70930605 TCAGTCTCCTTTGCTGAAAATGG - Intergenic
1069779796 10:70948039-70948061 TCAGACTCCTTGGCCAAGTATGG - Intergenic
1070096239 10:73340534-73340556 ACAGGCTCCTGGGCAAAAAGGGG - Intronic
1071326188 10:84520730-84520752 AGAGACTCCATGGCAAGAAATGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072033644 10:91544285-91544307 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1072126317 10:92448404-92448426 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1073166488 10:101458167-101458189 TAATACTACTTGGCAATAAAAGG + Intronic
1075413413 10:122245838-122245860 TCAGCCTCCTTGTCTAAAATAGG - Intronic
1075418656 10:122284739-122284761 CCAGACTCCTTTCCAAAGAAAGG + Intronic
1076226635 10:128781838-128781860 TCACACTCATTGGCCAAAAGAGG - Intergenic
1076647483 10:131963151-131963173 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1077150115 11:1069257-1069279 ACAGTCTCCTTTGCAAAAAGTGG + Intergenic
1078100040 11:8324692-8324714 TCTGACTCCTTGTCTACAAAAGG + Intergenic
1078560758 11:12369981-12370003 TCATACTCGATGGCAAAAACTGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080892797 11:36424075-36424097 TGAGTCTCCGTGGAAAAAAATGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083188089 11:61029483-61029505 TGAAACTCTATGGCAAAAAAAGG + Intergenic
1084449187 11:69223222-69223244 TAAGATTACTTGGCAATAAAAGG - Intergenic
1084697254 11:70763045-70763067 TCAGGCTCCTTGGCAGGGAAAGG - Intronic
1085731220 11:79001017-79001039 TGAGACTCCATCTCAAAAAAAGG + Intronic
1085898476 11:80668041-80668063 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
1086958201 11:92955914-92955936 TCAGTTTCTTTGGCATAAAATGG + Intergenic
1088138706 11:106590011-106590033 TAAACCTCCTTGACAAAAAATGG + Intergenic
1088793332 11:113245872-113245894 TCAGCATCCTTGGGAAACAAGGG - Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1089641323 11:119849111-119849133 TCAGCCTCCTTGACAAACACAGG - Intergenic
1090898837 11:131006782-131006804 TCAGACTCCTTACCTAAAAGGGG - Intergenic
1092803847 12:12200433-12200455 TCAGCCTCCTTGGAAGAAAAGGG - Intronic
1093935463 12:24995762-24995784 TCAGATTACTTGGCAAGTAAAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096392931 12:51243392-51243414 TCAGACACTCTGACAAAAAATGG - Intronic
1097130198 12:56805958-56805980 TCAGAAACCTTGGGACAAAAAGG + Intergenic
1098464934 12:70775817-70775839 TCCAACTCCTTGGCCAAGAATGG - Intronic
1098465656 12:70783695-70783717 ACAGGCTCCTGGGCAGAAAAGGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098663875 12:73135428-73135450 TCAGAGTCCTTGAAACAAAAGGG - Intergenic
1098901061 12:76112293-76112315 TCAGACTGCTTTGAAAATAATGG - Intergenic
1099915962 12:88893611-88893633 TCTGGCTGCTTTGCAAAAAATGG + Intergenic
1101096554 12:101347838-101347860 TGAGACTCCATCTCAAAAAAAGG - Intronic
1102486099 12:113258452-113258474 TGAGACTCCATCTCAAAAAAAGG + Intronic
1103370949 12:120419023-120419045 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
1106087344 13:26555456-26555478 TCAGACTCCTTTGCAGCTAAAGG + Intergenic
1108509239 13:51139975-51139997 TCACACTTCTTACCAAAAAAGGG - Intergenic
1108948074 13:56047817-56047839 TCAGAATACTTGGCAAAAATAGG + Intergenic
1110009651 13:70315781-70315803 ACAGACTCCTTGTACAAAAACGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110720052 13:78751490-78751512 TCAGAATCAGTGGCTAAAAAGGG + Intergenic
1111499312 13:89094747-89094769 TGAGACTCCATCTCAAAAAATGG + Intergenic
1112187052 13:97137546-97137568 TCTGGCTCCTTGGCAAATAACGG - Intergenic
1112258141 13:97853264-97853286 TCACACTGCTTTTCAAAAAATGG + Intergenic
1113503049 13:110793403-110793425 ACAGGCTCCTTGGCAGAAAGGGG + Intergenic
1114308788 14:21447085-21447107 TCAGACTGCATGACAACAAAAGG + Intronic
1115261930 14:31463218-31463240 TCAGTCTCCTTGGAAAGAAAAGG - Intergenic
1116268824 14:42733514-42733536 TCAGACTGGTTAGCAAAAATTGG + Intergenic
1116294533 14:43089820-43089842 TCATAATCTTTGGGAAAAAATGG + Intergenic
1118882007 14:69837115-69837137 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1120590025 14:86364053-86364075 ACAGGCTCCTGGGCAGAAAAGGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121183832 14:91949546-91949568 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123715777 15:23029867-23029889 TGAGACTCCGTCTCAAAAAAAGG + Intronic
1124044267 15:26134092-26134114 AAAGACTCCTTGGAAACAAATGG + Intergenic
1124369581 15:29096261-29096283 TCATCCTCCTTGGCAGAAGAAGG - Intronic
1124652098 15:31482018-31482040 TCAGTGTCCTTGGCCAAGAACGG + Exonic
1127228328 15:56959607-56959629 TTAGACTCTTTGAGAAAAAAAGG - Intronic
1127506044 15:59598931-59598953 TGAGACTCCATCTCAAAAAAAGG - Intronic
1127761340 15:62142455-62142477 TCATTCTCCTTGGCAGAAGATGG + Intergenic
1129061160 15:72861358-72861380 TCAGCCTCCCAGGCAAAAATGGG + Intergenic
1129252634 15:74317359-74317381 CCAGACTCCATTTCAAAAAAAGG + Intronic
1129506871 15:76088783-76088805 TGAGACTCCATCTCAAAAAAGGG + Intronic
1129864261 15:78891524-78891546 TCAGCCTCCTCGGAAGAAAAGGG + Exonic
1131035455 15:89218992-89219014 ACAGAGTCCTTGGAAAAAGAAGG + Exonic
1133626512 16:7575144-7575166 TGAGACTCCATCTCAAAAAAAGG - Intronic
1133974152 16:10588458-10588480 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1134288022 16:12879288-12879310 TGAGACTCCTTCTCAAAAAAGGG - Intergenic
1135002210 16:18786348-18786370 TGAGACTCCGTCTCAAAAAACGG + Intronic
1135091629 16:19522284-19522306 TCAGACTCCTAGGCGAGAAAAGG + Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136565925 16:31070217-31070239 TAAGACTCCGTCTCAAAAAAAGG - Intronic
1137053659 16:35733325-35733347 ACAGACACCTTGGCAACAACAGG - Intergenic
1137706058 16:50536592-50536614 CCAGACTCCATCTCAAAAAAAGG + Intergenic
1138116339 16:54363731-54363753 TCAGACACATTAGCAACAAAGGG + Intergenic
1138355441 16:56374155-56374177 TGAGACTCCATCTCAAAAAATGG + Intronic
1139585068 16:67897376-67897398 TCAGACACCATGGCAACAGAGGG - Intronic
1140976599 16:80065463-80065485 TCAGGCCCCTTGCCAATAAAGGG - Intergenic
1141050277 16:80755272-80755294 CCAGACTCCTTGGTAATTAAAGG - Intronic
1142358458 16:89615128-89615150 TCAGTCTCCTTGTCGACAAAAGG + Intronic
1145929598 17:28675551-28675573 TCAGAGGCCTTTGCCAAAAATGG + Intronic
1146086912 17:29838388-29838410 GCAGACTCCTAGGCAGACAATGG + Intronic
1146292653 17:31621679-31621701 ACAGAGTCCTTGGCAAAGATTGG - Intergenic
1146741087 17:35284214-35284236 TCTTACTGCTTGGCAGAAAATGG - Intergenic
1147707515 17:42437177-42437199 TGAGACTCCGTCTCAAAAAAAGG + Intergenic
1147868884 17:43573239-43573261 TGAGACTCCATCTCAAAAAAAGG + Intronic
1147899072 17:43772149-43772171 GCAGATTCCTTGCCAAACAATGG - Intronic
1152826252 17:82467056-82467078 TGAGACTCCATCTCAAAAAAGGG - Intronic
1154357547 18:13633394-13633416 ACAGGCTCCTGGGCAAAAAGGGG - Intronic
1156077284 18:33295240-33295262 ACATATTCATTGGCAAAAAAAGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1158804478 18:60952967-60952989 TCACAGTACTTGGCAGAAAATGG - Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1163706021 19:18813829-18813851 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1163982903 19:20918352-20918374 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
1164033730 19:21434959-21434981 TCAGCCTCCTGGGCAAACCAGGG + Intronic
1164884092 19:31762062-31762084 CGAGACTCCTTCTCAAAAAAAGG - Intergenic
1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG + Intergenic
1166399705 19:42469323-42469345 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167923322 19:52802663-52802685 TGAGACTCCATCTCAAAAAAAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1202664786 1_KI270708v1_random:108185-108207 TGAGACTCCATCTCAAAAAAAGG - Intergenic
925614205 2:5729844-5729866 TCAGTTTCCTTGAGAAAAAAAGG + Intergenic
925769491 2:7268096-7268118 TAAGATTCCTTGGAAAAAGAAGG + Intergenic
926197646 2:10773392-10773414 TGAGACTCCATCTCAAAAAAAGG - Intronic
926300593 2:11599349-11599371 TGAGACTCCGTCTCAAAAAAAGG - Intronic
926560963 2:14416904-14416926 TGAGACTCCATCTCAAAAAAAGG + Intergenic
926651501 2:15351663-15351685 TGAGACTCCATAGAAAAAAAAGG + Intronic
926921267 2:17942657-17942679 TCAGTCTCCTTGGTAAAATGAGG - Intronic
927768285 2:25833951-25833973 TCAGACTCAAAGGCAAGAAACGG - Intronic
927850764 2:26497921-26497943 TAAAAATCTTTGGCAAAAAAGGG - Intronic
929993289 2:46807617-46807639 TGAGACTCCGTCTCAAAAAAAGG + Intergenic
930148815 2:48036548-48036570 TAAGACTCCATCTCAAAAAAAGG - Intergenic
930197656 2:48525490-48525512 TCAGATACCATGGCAATAAATGG + Intergenic
931733962 2:65177561-65177583 ACAGGCTCCTGGGCAGAAAAAGG - Intergenic
933063572 2:77768079-77768101 ACAGGCTCCTGGGCAAAAAAGGG + Intergenic
933948752 2:87310207-87310229 TCACAAACCTTGGCAAGAAAAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935446449 2:103161652-103161674 GCTGACTCCCTGGCTAAAAATGG + Intergenic
936331445 2:111551389-111551411 TCACAAACCTTGGCAAGAAAAGG + Intergenic
936949015 2:117958474-117958496 TCAGACTGCTGTGGAAAAAAGGG + Exonic
938985102 2:136567476-136567498 TCAGTCTCCTTGGCAAACAGGGG + Intergenic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941816877 2:169804556-169804578 TGAGACTCCATCTCAAAAAAGGG - Intronic
943129326 2:183837645-183837667 GCAGGCTCCTGGGCAGAAAAGGG + Intergenic
944695836 2:202199807-202199829 TCAGACACTCTGACAAAAAATGG + Intergenic
945330139 2:208529937-208529959 ACAGACTCCTGGGCAGAAAAGGG - Intronic
947784552 2:232804501-232804523 TGAGACTCCATCTCAAAAAAAGG - Intronic
947898918 2:233703217-233703239 TCTAATTCCTTGGCATAAAATGG + Intronic
948998832 2:241600182-241600204 CAAGACTCCTTCTCAAAAAAAGG + Intronic
1168958492 20:1851443-1851465 TCAGTTTCCTTAGCAAAGAATGG - Intergenic
1172680198 20:36708070-36708092 TGAGACTCCATTTCAAAAAAAGG + Intronic
1174621661 20:51879635-51879657 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
1177864286 21:26494568-26494590 TCAAAGACCTTGGCAAAAGATGG + Intronic
1178100572 21:29264645-29264667 TCAGATTCCTTGGCATAGCAAGG - Intronic
1178251295 21:31005875-31005897 TCAGTCTCCTTGATAAAAAATGG - Intergenic
1179028200 21:37697839-37697861 TCAGTCTCCTAGGCAAATAGGGG + Intronic
1180299458 22:11025419-11025441 TGAGACTCCGTCTCAAAAAAAGG + Intergenic
1180331515 22:11485104-11485126 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1180673634 22:17572173-17572195 TGAGACTCCATCTCAAAAAAAGG + Intronic
1181631496 22:24153980-24154002 TCAGACACATTGCCAAAGAAGGG - Intronic
1181684379 22:24518374-24518396 TCAGAACTCTTGGAAAAAAAAGG + Intronic
1182310382 22:29400827-29400849 TCTGCCTTCTTGGCAAAATATGG + Intronic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1183136743 22:35896261-35896283 AAAGACTCCATGGCCAAAAATGG - Intronic
1185125752 22:49009794-49009816 TCAGGATCCTGGGCATAAAAAGG + Intergenic
950386764 3:12666063-12666085 CCAGACTCTGTCGCAAAAAAAGG + Intergenic
952010692 3:28897626-28897648 CCAGACTCCATCTCAAAAAAAGG - Intergenic
952144507 3:30517316-30517338 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
952419476 3:33118372-33118394 TCACACTCCTGGCCAGAAAAAGG - Intronic
954043612 3:47910027-47910049 CCAGATACCTTGGCAAAAAATGG - Intronic
954213823 3:49113105-49113127 TCAAGCTCCTTGTCTAAAAAGGG + Intronic
956882264 3:73522500-73522522 TTAGTCTCCTTGGCAGTAAAAGG + Intronic
957327335 3:78713348-78713370 TAAGACTACTTAGAAAAAAAAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962414165 3:135167313-135167335 TCAGACTCAGTGGGAAAAGATGG + Intronic
962809981 3:138951456-138951478 ACATACTCCTTGGGACAAAATGG - Exonic
963617562 3:147561556-147561578 TGAGACTCCATCTCAAAAAAAGG - Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
966256228 3:177918777-177918799 TCAGTCTCCTTGGCTACCAAGGG - Intergenic
966691766 3:182748794-182748816 TGAGACTTCTTCTCAAAAAAAGG + Intergenic
969004904 4:4011306-4011328 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
974023418 4:56711491-56711513 ACAGGCTCCTGGGCAGAAAAGGG + Intergenic
974195349 4:58567393-58567415 TAAGACTTAGTGGCAAAAAATGG - Intergenic
974285156 4:59855854-59855876 ACAGACTCCTTGGCGGAAAGGGG - Intergenic
975020605 4:69482616-69482638 TGAGACTCCATCTCAAAAAAAGG - Intronic
975438232 4:74379064-74379086 TCAGACCCCATCACAAAAAAAGG - Intronic
976099108 4:81541568-81541590 TCAGATTCGTTGGCACAAAAGGG + Intronic
976288872 4:83397141-83397163 TGAGACTCCATCTCAAAAAAAGG + Intergenic
976730503 4:88256329-88256351 TCAGACTCCATCTCAAAAAAAGG - Intergenic
976921489 4:90449450-90449472 ACAGGCTCCTGGGCAGAAAAGGG - Intronic
977498347 4:97805216-97805238 TGAGACTCCATCTCAAAAAAAGG - Intronic
979347624 4:119607094-119607116 TCAGAATCCTTGACAACAATGGG + Exonic
982247509 4:153368454-153368476 CCAGACTCCCTGGCAACTAATGG + Intronic
982471719 4:155799795-155799817 TCAGATTCCTTGACAGAAATCGG + Intronic
982536137 4:156608473-156608495 TCAGACTCCTTGGCAGCACATGG + Intergenic
984671264 4:182490545-182490567 TCAGATTCCAGGGGAAAAAATGG + Intronic
984951437 4:185010727-185010749 TCACCCTACATGGCAAAAAAAGG + Intergenic
985291270 4:188390659-188390681 CAAGACTCCTAGGCTAAAAAAGG - Intergenic
989471033 5:41819044-41819066 CCAGAGACCTTGTCAAAAAATGG - Intronic
990582912 5:57182382-57182404 TGAGACTCCATCTCAAAAAAAGG - Intronic
991695764 5:69269607-69269629 TTTGACTCCTTGACAAAAATGGG + Intronic
992025790 5:72667421-72667443 GCAGAACCCTTGGCAAAAAATGG - Intergenic
994104577 5:95932421-95932443 AGAGACACTTTGGCAAAAAAGGG + Intronic
994362444 5:98868106-98868128 TCGAACTCCTTGGCGTAAAAGGG - Intronic
994725470 5:103430020-103430042 TGAGACTCCATCTCAAAAAAAGG + Intergenic
995868163 5:116715079-116715101 TCAAACTCCTTGGCATACTATGG + Intergenic
997210698 5:132075093-132075115 TCTGACTCCTTGGGATGAAATGG - Intronic
999976133 5:156913830-156913852 TCAGTTTCCTTGGCTGAAAATGG + Intergenic
1000089882 5:157921120-157921142 TCAGACTCCATCTCAAAACAAGG - Intergenic
1000318498 5:160115679-160115701 TGAGACTCCATCTCAAAAAAAGG + Intronic
1000642170 5:163715868-163715890 TCAGACACCTAGGAAAATAATGG + Intergenic
1002499267 5:179636860-179636882 TCAGAGGTCTTGGCAAAGAATGG - Intergenic
1002502409 5:179655661-179655683 TCAGAGGTCTTGGCAAAGAATGG + Intergenic
1002503595 5:179663700-179663722 CCAGACTACTTGGAAACAAATGG + Intergenic
1003415635 6:5905541-5905563 TCAGCCTCCCTGGTAGAAAATGG + Intergenic
1003579077 6:7322992-7323014 TCAGAATCCTTGGGAAACATGGG + Intronic
1003909112 6:10727350-10727372 TGAGACTCCATCTCAAAAAAAGG - Intronic
1004136601 6:12973177-12973199 TCAGACTCCTTTTAAACAAAGGG - Intronic
1004202645 6:13563887-13563909 TCTGCCTCCTTGGCCAATAAAGG - Intergenic
1004990312 6:21130152-21130174 ACAGAATACTTGGAAAAAAAGGG - Intronic
1005291761 6:24386733-24386755 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1006060818 6:31417655-31417677 TGAGACTCCATCCCAAAAAAAGG - Intergenic
1006497571 6:34434837-34434859 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1008538753 6:52528234-52528256 TCAGTTTCCTTGGCTATAAAAGG + Intronic
1008909603 6:56719088-56719110 TCACACTCCTTTTGAAAAAATGG + Intronic
1010519687 6:76817924-76817946 ACAGGCTCCTGGGCAAAAAGGGG + Intergenic
1010550316 6:77213889-77213911 CAAGACTGCTTGGAAAAAAAGGG + Intergenic
1010634855 6:78245755-78245777 TGAGACTCCATCCCAAAAAAAGG - Intergenic
1011834598 6:91416095-91416117 TCAGATTTCTGGGGAAAAAATGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1013453393 6:110307500-110307522 ACAGACAGATTGGCAAAAAATGG - Intronic
1014095936 6:117461315-117461337 TGAGACTCCATCTCAAAAAAAGG + Intronic
1014624832 6:123712714-123712736 TCAGACTCCTTTTCAATTAATGG - Intergenic
1014730029 6:125021891-125021913 TGAGACTCCATCTCAAAAAAAGG - Intronic
1015184093 6:130393785-130393807 TCAGACATCATGGCATAAAATGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015505188 6:133978025-133978047 TCAGCCTCCCTGGCAACAACTGG - Intronic
1017435070 6:154408034-154408056 TGAGACTCCGTCTCAAAAAAAGG - Intronic
1017463707 6:154674981-154675003 TCAGTTTCCTTGGCTTAAAATGG - Intergenic
1018106657 6:160493822-160493844 ACAGAGTCATTGGCAAACAATGG + Intergenic
1018678402 6:166242674-166242696 TGAGACTCCGTCTCAAAAAAAGG + Intergenic
1018776976 6:167026350-167026372 TGAGACTCCGTCTCAAAAAAAGG + Intronic
1019897961 7:3997818-3997840 ACAGACTCCTGGGCAGAAGAAGG - Intronic
1021021148 7:15600009-15600031 ACAGGCTCCTGGGCAAAAGAGGG - Intergenic
1022430983 7:30320138-30320160 TCAGAGCTCTTGGAAAAAAATGG - Intronic
1023249008 7:38237535-38237557 TGAGACTCCTTCTCAAAAAAAGG + Intergenic
1023602954 7:41898599-41898621 TAAGACTCCGTCTCAAAAAAAGG - Intergenic
1024963201 7:54999584-54999606 TCAGACTTCTTGGAAAACCATGG - Intergenic
1025252450 7:57360854-57360876 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1028440479 7:90853992-90854014 TCAGACTCCTCCACAAAACAAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030968967 7:116030052-116030074 TGAGACTCCATCTCAAAAAAAGG + Intronic
1034621648 7:152461753-152461775 TGAGACTCCATCTCAAAAAAAGG + Intergenic
1034861135 7:154595705-154595727 ACAGCCTCCTTTGCAAATAAAGG - Intronic
1036474955 8:9084699-9084721 ACAAACTCCTTGGAAAAAGAGGG - Intronic
1038191585 8:25326003-25326025 CCTGACTGCTTGGAAAAAAATGG - Intronic
1038391704 8:27208023-27208045 TCAGAATCCTTCCCAAAACAGGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039652293 8:39354646-39354668 ACAGACACCTTGCCAAAAAAAGG + Intergenic
1044336440 8:90989235-90989257 TGAGATTCATTGGCAAATAAAGG + Intergenic
1044588855 8:93894455-93894477 TGAGACTCCATCTCAAAAAAAGG - Intronic
1046117400 8:109800759-109800781 TCAGACTCCATGGAGAAAATGGG - Intergenic
1046503763 8:115111544-115111566 ACAGGCTCCTGGGCAGAAAAAGG - Intergenic
1047553700 8:125905763-125905785 TCATCCTCCTTGGCCAAAAAAGG - Intergenic
1047944036 8:129857104-129857126 TCAGACTTACTGGAAAAAAAAGG - Intronic
1050694981 9:8268757-8268779 TCAGAATCCTTCTCAAAACAGGG - Intergenic
1051029632 9:12658607-12658629 ACAGGCTCCTTGGCAGAAGAGGG - Intergenic
1051175846 9:14359133-14359155 ACAATCTCCTTGGCAAGAAAGGG - Intronic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053089925 9:35265831-35265853 AGAGACTCCATCGCAAAAAAAGG - Intronic
1053154234 9:35763999-35764021 TCAGCCTCCTGAGTAAAAAAAGG - Intergenic
1055894335 9:81158117-81158139 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1056062363 9:82897004-82897026 TCAGAAACCTTGAGAAAAAATGG + Intergenic
1057730976 9:97607873-97607895 TGAGACTCCGTCTCAAAAAAAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059591663 9:115669073-115669095 CCAGCCTACTTGCCAAAAAATGG + Intergenic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1061647258 9:132014203-132014225 TAAGACTCCGTCTCAAAAAAAGG + Intronic
1062647052 9:137553268-137553290 TGAGACTCCGTCTCAAAAAAGGG + Intergenic
1203486512 Un_GL000224v1:60819-60841 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1203499133 Un_KI270741v1:2718-2740 TGAGACTCCATCTCAAAAAAAGG - Intergenic
1186458743 X:9731504-9731526 ACAGACTCATGGGGAAAAAATGG + Intronic
1187380341 X:18795965-18795987 TGAGACTCCATCTCAAAAAAAGG - Intronic
1187949231 X:24455506-24455528 TCAGAGTCCTCTGCAAATAATGG + Intergenic
1188577812 X:31673594-31673616 TGAGACTCCATCTCAAAAAAAGG + Intronic
1188597971 X:31924265-31924287 TCCGACTCCTTGCTCAAAAATGG - Intronic
1188795908 X:34464517-34464539 TCAGTCTCTTTGGGGAAAAAGGG + Intergenic
1188822733 X:34795525-34795547 TCAGGCTCCCTTGCAAGAAAAGG + Intergenic
1189404671 X:40710414-40710436 TCTGACTCCTTTACAGAAAATGG + Intronic
1190226698 X:48551633-48551655 TGAGACTCCCTCTCAAAAAAAGG - Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193180718 X:78453208-78453230 GCAATTTCCTTGGCAAAAAAGGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195287431 X:103398541-103398563 TCAGACTAGATGGCAAAGAAAGG - Intergenic
1195454299 X:105051147-105051169 ACAGATTCCTGGGCAAAAAGGGG - Intronic
1195982313 X:110592462-110592484 ACAGACTCTTTGAAAAAAAAAGG - Intergenic
1196838124 X:119832268-119832290 TGAGACTCCGTCTCAAAAAAAGG - Intergenic
1197933920 X:131721389-131721411 TGAGACTCCCTCTCAAAAAAAGG - Intergenic
1198061205 X:133046772-133046794 TCAGTCACCTTTGGAAAAAAAGG + Intronic
1198174763 X:134144417-134144439 GCAGACTTCTTAACAAAAAAAGG - Intergenic
1198912342 X:141628711-141628733 TCAGACTCCTTGGATAACCAGGG + Intronic
1200962987 Y:9011989-9012011 TCTGACTCCTTGCCCAAAAGAGG - Intergenic
1201272530 Y:12269042-12269064 GCAGACTCCATCTCAAAAAAAGG - Intergenic
1202150116 Y:21836793-21836815 TCTGACTCCTTGCCCAAAAGAGG + Intergenic