ID: 1182484248

View in Genome Browser
Species Human (GRCh38)
Location 22:30629922-30629944
Sequence TTACTGTTCCTCCTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182484248_1182484256 15 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484256 22:30629960-30629982 AAGCCCTCCACCCTGGCCACAGG No data
1182484248_1182484258 18 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG No data
1182484248_1182484264 28 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484264 22:30629973-30629995 TGGCCACAGGTGGTGTCTGTGGG No data
1182484248_1182484255 8 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484255 22:30629953-30629975 TGGGATGAAGCCCTCCACCCTGG No data
1182484248_1182484263 27 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484263 22:30629972-30629994 CTGGCCACAGGTGGTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182484248 Original CRISPR TTACTGTTCCTCCTGGAGGC AGG (reversed) Intergenic