ID: 1182484250

View in Genome Browser
Species Human (GRCh38)
Location 22:30629926-30629948
Sequence CTCCTTACTGTTCCTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182484250_1182484255 4 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484255 22:30629953-30629975 TGGGATGAAGCCCTCCACCCTGG No data
1182484250_1182484263 23 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484263 22:30629972-30629994 CTGGCCACAGGTGGTGTCTGTGG No data
1182484250_1182484264 24 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484264 22:30629973-30629995 TGGCCACAGGTGGTGTCTGTGGG No data
1182484250_1182484258 14 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG No data
1182484250_1182484256 11 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484256 22:30629960-30629982 AAGCCCTCCACCCTGGCCACAGG No data
1182484250_1182484266 27 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484266 22:30629976-30629998 CCACAGGTGGTGTCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182484250 Original CRISPR CTCCTTACTGTTCCTCCTGG AGG (reversed) Intergenic