ID: 1182484258

View in Genome Browser
Species Human (GRCh38)
Location 22:30629963-30629985
Sequence CCCTCCACCCTGGCCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182484248_1182484258 18 Left 1182484248 22:30629922-30629944 CCTGCCTCCAGGAGGAACAGTAA No data
Right 1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG No data
1182484251_1182484258 11 Left 1182484251 22:30629929-30629951 CCAGGAGGAACAGTAAGGAGTGG No data
Right 1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG No data
1182484250_1182484258 14 Left 1182484250 22:30629926-30629948 CCTCCAGGAGGAACAGTAAGGAG No data
Right 1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182484258 Original CRISPR CCCTCCACCCTGGCCACAGG TGG Intergenic