ID: 1182485592

View in Genome Browser
Species Human (GRCh38)
Location 22:30636751-30636773
Sequence CAGCGAGTGCCGCCTGGCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182485592_1182485600 25 Left 1182485592 22:30636751-30636773 CCCATGCCAGGCGGCACTCGCTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1182485600 22:30636799-30636821 TTTGGCACGTCCATGGCCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 66
1182485592_1182485598 18 Left 1182485592 22:30636751-30636773 CCCATGCCAGGCGGCACTCGCTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1182485598 22:30636792-30636814 TCTCACCTTTGGCACGTCCATGG 0: 1
1: 0
2: 0
3: 2
4: 79
1182485592_1182485597 7 Left 1182485592 22:30636751-30636773 CCCATGCCAGGCGGCACTCGCTG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1182485597 22:30636781-30636803 CTACTGCTCAGTCTCACCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182485592 Original CRISPR CAGCGAGTGCCGCCTGGCAT GGG (reversed) Exonic
900053032 1:609620-609642 CCGCGTGTGCCGCCAGGCCTGGG - Intergenic
900053142 1:610092-610114 CCGCGTGTGCCGCCAGGCCTGGG - Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
904699846 1:32351708-32351730 CTCCGGGTGCCGCCTGGCACTGG - Intronic
914919604 1:151838438-151838460 CGGCGAGTGCGGGCTGGTATCGG + Exonic
1066000801 10:31102643-31102665 CAACCAGTGCTACCTGGCATGGG + Intergenic
1067068046 10:43114669-43114691 CAGCGAGGGCCGGCGGGCACCGG - Exonic
1069907229 10:71738985-71739007 CAGCAAGCGCCTCCTGCCATGGG - Intronic
1079642963 11:22829784-22829806 CAGTTAGCGCCGCCTGGCCTGGG - Exonic
1083065940 11:59924054-59924076 CAGCAAGTGGCGCCTAACATGGG + Intergenic
1083171029 11:60924291-60924313 CACCGAGTCCCTCCTGGCAGAGG + Intergenic
1084656678 11:70523685-70523707 CAGCGAGCGCCTCCTGACACAGG - Intronic
1089875907 11:121722340-121722362 CAGCCAGTCCTGCCTGGGATGGG - Intergenic
1096911771 12:54991088-54991110 CAGCGAGTGCAGTCTGACTTTGG - Intergenic
1099844075 12:88006560-88006582 CAACTTGTGCCTCCTGGCATGGG + Intronic
1101660044 12:106757670-106757692 CAGTGAGAGCCGCCTTTCATAGG + Intronic
1101716735 12:107318860-107318882 CAGCGAGTGCCGCGGGGCGCGGG - Exonic
1108020391 13:46122063-46122085 GAGCGAGTGCCACCTGGAAGGGG + Intergenic
1111911124 13:94313168-94313190 CAGAGAGAGCCGCCTGTCACAGG + Intronic
1112503395 13:99958748-99958770 CAGCGAGTCCCGCTTGGCCCCGG + Intergenic
1119667906 14:76498156-76498178 CAGGGAGTGCTGCCTGGTGTGGG - Intronic
1122721644 14:103725608-103725630 CAGTGAGGGCCTCCTGGCAGGGG + Intronic
1124627407 15:31316276-31316298 CAGAGAGGACCGGCTGGCATGGG - Intergenic
1125721588 15:41847621-41847643 GAGAGAGTGCAGCCTGGCATGGG - Intronic
1126250751 15:46565532-46565554 CAGTGAATGCTGCCTGGCCTGGG + Intergenic
1135616789 16:23917627-23917649 CAGTGACCGCCACCTGGCATGGG - Intronic
1136242079 16:28950933-28950955 CAGCGACTTTCGCCTTGCATTGG - Exonic
1137580805 16:49632433-49632455 CAGAGAATGCCGCCTTGCCTGGG + Intronic
1138477423 16:57280066-57280088 CAGGGAGGGCTTCCTGGCATAGG - Intronic
1142276547 16:89121965-89121987 CGGCGTGTCCCGCCTGGCCTGGG + Intronic
1142276588 16:89122102-89122124 CAGTGTGTCCCGCCTGGCCTGGG + Intronic
1142276627 16:89122239-89122261 CAGTGTGTCCCGCCTGGCCTGGG + Intronic
1142684345 17:1569127-1569149 CAGCAAATGCAGCCTGGCAGGGG + Intergenic
1144692890 17:17280627-17280649 GAGCGTGCGCCGCCTGGCAGCGG + Intronic
1151439368 17:74118340-74118362 CACCCAGGGCCGCCTGGCAGGGG + Intergenic
1152630229 17:81407632-81407654 CAGACATTGCCGCCTGGCAGGGG + Intronic
1161123057 19:2540694-2540716 CAGCGAGGCCCGCCGGGCAGCGG + Intronic
1164595462 19:29528578-29528600 CAGCGATCGCAGCCTTGCATCGG + Intronic
1164965602 19:32480255-32480277 GAGCGAGTGCAGCGTGGCCTGGG + Intronic
1167948000 19:53004679-53004701 CAGTGGGAGCCGCCTGGCCTGGG + Intergenic
1168257200 19:55173523-55173545 CAGCGAGTGCCACTGGGCAATGG + Exonic
926329258 2:11811165-11811187 CCCCGTGTGCAGCCTGGCATAGG + Intronic
928370467 2:30736701-30736723 CAGCGGGAGCCAGCTGGCATGGG - Intronic
937149315 2:119674856-119674878 CAGCCAGGGCCACCTGGCAGGGG + Intergenic
937559509 2:123205198-123205220 CAGTGAATGCTGCCTGGCCTGGG + Intergenic
942450455 2:176105570-176105592 CAGCCAGCGCCGCCTGCCCTGGG + Intronic
942734682 2:179096659-179096681 TAGTGAGTGCTGCCTGGCCTGGG + Intergenic
944490378 2:200252836-200252858 CAGCCAGTGCCTCCTAGCCTAGG + Intergenic
1172166459 20:32902726-32902748 CTGCGGGTGGGGCCTGGCATTGG + Intronic
1174501000 20:50984223-50984245 CAGCTACTGGAGCCTGGCATAGG - Intergenic
1176372330 21:6069582-6069604 CAGGGAGTGCCGACTGGTGTCGG - Intergenic
1179401585 21:41089623-41089645 CAGCGACTGCTGCCAGGTATAGG - Intergenic
1179751188 21:43468957-43468979 CAGGGAGTGCCGACTGGTGTCGG + Intergenic
1182485592 22:30636751-30636773 CAGCGAGTGCCGCCTGGCATGGG - Exonic
1182623498 22:31630417-31630439 GAGGGGGTGCCGGCTGGCATTGG - Intronic
950459689 3:13113719-13113741 CAGCGTGGGCCGCATGGCAGGGG + Intergenic
953883057 3:46701405-46701427 CACCGAGCGCCGGCTGGCAGGGG + Exonic
954701343 3:52452430-52452452 CAGCGGGTCCAGGCTGGCATGGG - Intronic
968179083 3:196577584-196577606 CAGTGAGGGCCGCCATGCATGGG + Exonic
968317540 3:197736980-197737002 CTGCGAGCGCGGCCTGGGATTGG - Intronic
968545240 4:1194792-1194814 CAGCGGGGGCTGCCTGGCAGAGG + Intronic
971819168 4:31530041-31530063 CAGGCAGTGCCCCCTGGCTTGGG - Intergenic
976598148 4:86913687-86913709 CAGTGGGAGCCGCCTGGCCTGGG - Intronic
981298082 4:143156129-143156151 CAGTGAATGCCGCCAGGCCTGGG + Intergenic
986899326 5:12412772-12412794 CAGTGAATGCTGCCTGGCCTGGG + Intergenic
987302603 5:16609836-16609858 CAGTGAGTGCCGCCCAGCAATGG + Intronic
993582336 5:89677878-89677900 TAGTGAGTGCTGCCTGGCCTGGG - Intergenic
1001577789 5:172775411-172775433 CAGCCAGTGCTGCCAGACATGGG - Intergenic
1011204573 6:84877867-84877889 AAGAGAGTGCTGCCTGGCATAGG + Intergenic
1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG + Intronic
1020016879 7:4836406-4836428 CAGCGAGTACCGCATGGCGTCGG + Exonic
1021106620 7:16645796-16645818 CACCGCCTGCCGCCTGTCATTGG + Exonic
1023629331 7:42148196-42148218 GAACAAGTGCCGACTGGCATGGG + Intronic
1023874219 7:44278086-44278108 CAGCCAGGGGCGCCTGCCATGGG + Intronic
1029267525 7:99354050-99354072 CAGTGGGAGCCGCCTGGCCTGGG + Exonic
1029273492 7:99391028-99391050 CAGCGGGAGCCGCGTGGCCTGGG + Exonic
1030785192 7:113651746-113651768 CAGTGAGTGCCACTAGGCATTGG - Intergenic
1035264876 7:157685101-157685123 CCGCGGGTCCCGCCTGGCCTTGG + Intronic
1037373154 8:18201645-18201667 CAGCGTGGGCTGACTGGCATTGG + Intronic
1047744238 8:127832309-127832331 CAGCTAGTGATGCCTGCCATGGG - Intergenic
1051658925 9:19408503-19408525 CAGCGAGTGGCGTCCGGCCTCGG + Intergenic
1054870774 9:70045422-70045444 CACCCAGTGCCGCCTGCCATTGG - Intronic
1061496656 9:130978639-130978661 CAGCGAGAGCCACCGGACATGGG + Intergenic
1062402156 9:136377494-136377516 CAGGGACCGCCGCCTGCCATGGG + Intronic
1187652029 X:21420254-21420276 TAGCGAATGCTGCCTGGCCTGGG + Intronic
1190386003 X:49882755-49882777 CAGTGGGTGCCACCTGGGATTGG + Intergenic
1199316084 X:146379619-146379641 CAGTGAATGCTGCCTGGCCTGGG - Intergenic