ID: 1182490032

View in Genome Browser
Species Human (GRCh38)
Location 22:30665476-30665498
Sequence CAGGATCTGATGGGTTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4484
Summary {0: 1, 1: 1, 2: 108, 3: 1431, 4: 2943}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182490032_1182490039 15 Left 1182490032 22:30665476-30665498 CCTTATGAACCCATCAGATCCTG 0: 1
1: 1
2: 108
3: 1431
4: 2943
Right 1182490039 22:30665514-30665536 CAGAGGACTGCAGAAGTCTGAGG 0: 1
1: 0
2: 2
3: 24
4: 306
1182490032_1182490037 -2 Left 1182490032 22:30665476-30665498 CCTTATGAACCCATCAGATCCTG 0: 1
1: 1
2: 108
3: 1431
4: 2943
Right 1182490037 22:30665497-30665519 TGATCTGGTCCATTCAGCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182490032 Original CRISPR CAGGATCTGATGGGTTCATA AGG (reversed) Intronic
Too many off-targets to display for this crispr