ID: 1182490032 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:30665476-30665498 |
| Sequence | CAGGATCTGATGGGTTCATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4484 | |||
| Summary | {0: 1, 1: 1, 2: 108, 3: 1431, 4: 2943} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182490032_1182490039 | 15 | Left | 1182490032 | 22:30665476-30665498 | CCTTATGAACCCATCAGATCCTG | 0: 1 1: 1 2: 108 3: 1431 4: 2943 |
||
| Right | 1182490039 | 22:30665514-30665536 | CAGAGGACTGCAGAAGTCTGAGG | 0: 1 1: 0 2: 2 3: 24 4: 306 |
||||
| 1182490032_1182490037 | -2 | Left | 1182490032 | 22:30665476-30665498 | CCTTATGAACCCATCAGATCCTG | 0: 1 1: 1 2: 108 3: 1431 4: 2943 |
||
| Right | 1182490037 | 22:30665497-30665519 | TGATCTGGTCCATTCAGCAGAGG | 0: 1 1: 0 2: 0 3: 6 4: 104 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182490032 | Original CRISPR | CAGGATCTGATGGGTTCATA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||